Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
ARMCX4_chrX_101480456_101500807	101494719	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA19062.hp1 NA19062.hp1	a0030 a0030	a0030c0054 a0030c0054	a0030c0054t0001 a0030c0054t0001	a0030c0054t0001g0002 a0030c0054t0001g0002	1	326	0.0031	1	c.613 others(5): Show c.6135dupA	p.Leu others(6): Show p.Leu2046fs	ARMCX4	ENSG00000196440.12	transcript	ENST00000423738.5	protein_coding	6/6	6647/7729	6136/6873	2046/2290	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARMCX4_chrX_101480456_101500807	101494754	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19062.hp1 NA19062.hp1	a0030 a0030	a0030c0054 a0030c0054	a0030c0054t0001 a0030c0054t0001	a0030c0054t0001g0002 a0030c0054t0001g0002	1	326	0.0031	-1	c.616 others(5): Show c.6167delC	p.Pro others(6): Show p.Pro2056fs	ARMCX4	ENSG00000196440.12	transcript	ENST00000423738.5	protein_coding	6/6	6678/7729	6167/6873	2056/2290	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARMCX4_chrX_101480456_101500807	101494783	CT CT	C C	frameshift_variant frameshift_variant	HIGH	NA19062.hp1 NA19062.hp1	a0030 a0030	a0030c0054 a0030c0054	a0030c0054t0001 a0030c0054t0001	a0030c0054t0001g0002 a0030c0054t0001g0002	1	326	0.0031	-1	c.619 others(5): Show c.6197delT	p.Leu others(6): Show p.Leu2066fs	ARMCX4	ENSG00000196440.12	transcript	ENST00000423738.5	protein_coding	6/6	6708/7729	6197/6873	2066/2290	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARMCX4_chrX_101480456_101500807	101494797	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19062.hp1 NA19062.hp1	a0030 a0030	a0030c0054 a0030c0054	a0030c0054t0001 a0030c0054t0001	a0030c0054t0001g0002 a0030c0054t0001g0002	1	326	0.0031	-1	c.620 others(5): Show c.6209delC	p.Ala others(6): Show p.Ala2070fs	ARMCX4	ENSG00000196440.12	transcript	ENST00000423738.5	protein_coding	6/6	6720/7729	6209/6873	2070/2290		chrX	TogoVar
ARMCX4_chrX_101480456_101500807	101494825	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19062.hp1 NA19062.hp1	a0030 a0030	a0030c0054 a0030c0054	a0030c0054t0001 a0030c0054t0001	a0030c0054t0001g0002 a0030c0054t0001g0002	1	326	0.0031	1	c.623 others(10): Show c.6236_6237insG	p.Arg others(6): Show p.Arg2080fs	ARMCX4	ENSG00000196440.12	transcript	ENST00000423738.5	protein_coding	6/6	6748/7729	6237/6873	2079/2290		chrX	TogoVar
ARMCX4_chrX_101480456_101500807	101494835	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA19062.hp1 NA19062.hp1	a0030 a0030	a0030c0054 a0030c0054	a0030c0054t0001 a0030c0054t0001	a0030c0054t0001g0002 a0030c0054t0001g0002	1	326	0.0031	-1	c.624 others(5): Show c.6248delG	p.Gly others(6): Show p.Gly2083fs	ARMCX4	ENSG00000196440.12	transcript	ENST00000423738.5	protein_coding	6/6	6759/7729	6248/6873	2083/2290	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARMCX4_chrX_101480456_101500807	101495131	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA18981.hp2 NA18981.hp2	a0025 a0025	a0025c0059 a0025c0059	a0025c0059t0010 a0025c0059t0010	a0025c0059t0010g0002 a0025c0059t0010g0002	1	326	0.0031	1	c.654 others(5): Show c.6544dupC	p.His others(6): Show p.His2182fs	ARMCX4	ENSG00000196440.12	transcript	ENST00000423738.5	protein_coding	6/6	7056/7729	6545/6873	2182/2290	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARMCX4_chrX_101480456_101500807	101495293	AT AT	A A	frameshift_variant frameshift_variant	HIGH	NA19062.hp1 NA19062.hp1	a0030 a0030	a0030c0054 a0030c0054	a0030c0054t0001 a0030c0054t0001	a0030c0054t0001g0002 a0030c0054t0001g0002	1	326	0.0031	-1	c.670 others(5): Show c.6708delT	p.Phe others(6): Show p.Phe2236fs	ARMCX4	ENSG00000196440.12	transcript	ENST00000423738.5	protein_coding	6/6	7219/7729	6708/6873	2236/2290	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARPC3_chr12_110429823_110455337	110436200	CACTTCTA others(6): Show CACTTCTAAAACAG	C C	frameshift_variant others(3): Show frameshift_variant splice_acceptor_variant splice_region_variant intron_variant	HIGH	HG00099.hp1 HG00099.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0167 a0002c0002t0001g0167	1	334	0.0030	-13	c.380 others(22): Show c.380-9_383delCTGTTTTAGAAGT	p.Glu others(5): Show p.Glu127fs	ARPC3	ENSG00000111229.16	transcript	ENST00000228825.12	protein_coding	6/7	460/946	380/537	127/178		chr12	TogoVar
ARR3_chrX_70263334_70286840	70276151	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA18994.hp1 NA18994.hp1	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0001 a0003c0004t0001	a0003c0004t0001g0062 a0003c0004t0001g0062	1	319	0.0031	1	c.219 others(4): Show c.219dupA	p.Asp others(4): Show p.Asp74fs	ARR3	ENSG00000120500.19	transcript	ENST00000307959.9	protein_coding	6/17	289/1310	220/1167	74/388	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARR3_chrX_70263334_70286840	70276674	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19003.hp2 NA19003.hp2	a0002 a0002	a0002c0005 a0002c0005	a0002c0005t0001 a0002c0005t0001	a0002c0005t0001g0116 a0002c0005t0001g0116	1	319	0.0031	-1	c.414 others(4): Show c.414delG	p.Ile others(5): Show p.Ile139fs	ARR3	ENSG00000120500.19	transcript	ENST00000307959.9	protein_coding	8/17	483/1310	414/1167	138/388	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARSD_chrX_2898972_2934339	2907488	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA18991.hp1 NA18991.hp1	a0000 a0000	a0000c0022 a0000c0022	a0000c0022t0001 a0000c0022t0001	a0000c0022t0001g0172 a0000c0022t0001g0172	1	344	0.0029	1	c.156 others(5): Show c.1564dupG	p.Asp others(5): Show p.Asp522fs	ARSD	ENSG00000006756.16	transcript	ENST00000381154.6	protein_coding	10/10	1628/5145	1564/1782	522/593		chrX	TogoVar
ARSD_chrX_2898972_2934339	2915596	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18949.hp2 NA18949.hp2	a0007 a0007	a0007c0023 a0007c0023	a0007c0023t0034 a0007c0023t0034	a0007c0023t0034g0177 a0007c0023t0034g0177	1	344	0.0029	1	c.959 others(4): Show c.959dupG	p.Tyr others(5): Show p.Tyr322fs	ARSD	ENSG00000006756.16	transcript	ENST00000381154.6	protein_coding	6/10	1023/5145	959/1782	320/593		chrX	TogoVar
ARSD_chrX_2898972_2934339	2925646	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0010 a0010	a0010c0013 a0010c0013	a0010c0013t0007 a0010c0013t0007	a0010c0013t0007g0194 a0010c0013t0007g0194	1	344	0.0029	-1	c.163 others(4): Show c.163delG	p.Asp others(4): Show p.Asp55fs	ARSD	ENSG00000006756.16	transcript	ENST00000381154.6	protein_coding	2/10	227/5145	163/1782	55/593		chrX	TogoVar
ARSF_chrX_3036471_3117727	3112242	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0008 a0008	a0008c0019 a0008c0019	a0008c0019t0001 a0008c0019t0001	a0008c0019t0001g0076 a0008c0019t0001g0076	1	193	0.0052	1	c.146 others(5): Show c.1460dupT	p.Thr others(5): Show p.Thr488fs	ARSF	ENSG00000062096.15	transcript	ENST00000381127.6	protein_coding	11/11	1682/2165	1461/1773	487/590	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARSF_chrX_3036471_3117727	3112266	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0008 a0008	a0008c0019 a0008c0019	a0008c0019t0001 a0008c0019t0001	a0008c0019t0001g0076 a0008c0019t0001g0076	1	193	0.0052	1	c.148 others(10): Show c.1483_1484insA	p.Gly others(5): Show p.Gly495fs	ARSF	ENSG00000062096.15	transcript	ENST00000381127.6	protein_coding	11/11	1705/2165	1484/1773	495/590		chrX	TogoVar
ARSF_chrX_3036471_3117727	3112392	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0008 a0008	a0008c0019 a0008c0019	a0008c0019t0001 a0008c0019t0001	a0008c0019t0001g0076 a0008c0019t0001g0076	1	193	0.0052	-1	c.161 others(5): Show c.1612delC	p.Leu others(5): Show p.Leu538fs	ARSF	ENSG00000062096.15	transcript	ENST00000381127.6	protein_coding	11/11	1833/2165	1612/1773	538/590	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARSF_chrX_3036471_3117727	3112533	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0008 a0008	a0008c0019 a0008c0019	a0008c0019t0001 a0008c0019t0001	a0008c0019t0001g0076 a0008c0019t0001g0076	1	193	0.0052	1	c.175 others(5): Show c.1754dupG	p.Pro others(5): Show p.Pro586fs	ARSF	ENSG00000062096.15	transcript	ENST00000381127.6	protein_coding	11/11	1976/2165	1755/1773	585/590	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARSH_chrX_3001546_3039111	3027389	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0009 a0009	a0009c0011 a0009c0011	a0009c0011t0001 a0009c0011t0001	a0009c0011t0001g0061 a0009c0011t0001g0061	1	248	0.0040	-1	c.111 others(5): Show c.1116delG	p.Arg others(5): Show p.Arg373fs	ARSH	ENSG00000205667.3	transcript	ENST00000381130.3	protein_coding	7/9	1183/2482	1116/1689	372/562	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARSH_chrX_3001546_3039111	3027465	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0009 a0009	a0009c0011 a0009c0011	a0009c0011t0001 a0009c0011t0001	a0009c0011t0001g0061 a0009c0011t0001g0061	1	248	0.0040	1	c.119 others(5): Show c.1192dupC	p.Gln others(5): Show p.Gln398fs	ARSH	ENSG00000205667.3	transcript	ENST00000381130.3	protein_coding	7/9	1260/2482	1193/1689	398/562	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARSH_chrX_3001546_3039111	3033029	T T	TGG TGG	frameshift_variant frameshift_variant	HIGH	NA18940.hp1 NA18940.hp1	a0010 a0010	a0010c0013 a0010c0013	a0010c0013t0011 a0010c0013t0011	a0010c0013t0011g0047 a0010c0013t0011g0047	1	248	0.0040	2	c.133 others(11): Show c.1334_1335dupGG	p.Lys others(5): Show p.Lys446fs	ARSH	ENSG00000205667.3	transcript	ENST00000381130.3	protein_coding	9/9	1403/2482	1336/1689	446/562	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARSH_chrX_3001546_3039111	3033099	GT GT	G G	frameshift_variant frameshift_variant	HIGH	NA18940.hp1 NA18940.hp1	a0010 a0010	a0010c0013 a0010c0013	a0010c0013t0011 a0010c0013t0011	a0010c0013t0011g0047 a0010c0013t0011g0047	1	248	0.0040	-1	c.140 others(5): Show c.1405delT	p.Ser others(5): Show p.Ser469fs	ARSH	ENSG00000205667.3	transcript	ENST00000381130.3	protein_coding	9/9	1472/2482	1405/1689	469/562	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARSH_chrX_3001546_3039111	3033205	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA18940.hp1 NA18940.hp1	a0010 a0010	a0010c0013 a0010c0013	a0010c0013t0011 a0010c0013t0011	a0010c0013t0011g0047 a0010c0013t0011g0047	1	248	0.0040	1	c.151 others(5): Show c.1510dupG	p.Asp others(5): Show p.Asp504fs	ARSH	ENSG00000205667.3	transcript	ENST00000381130.3	protein_coding	9/9	1578/2482	1511/1689	504/562	INFO_REALIGN_3_PRIME	chrX	TogoVar
ARSH_chrX_3001546_3039111	3033340	CT CT	C C	frameshift_variant frameshift_variant	HIGH	NA18940.hp1 NA18940.hp1	a0010 a0010	a0010c0013 a0010c0013	a0010c0013t0011 a0010c0013t0011	a0010c0013t0011g0047 a0010c0013t0011g0047	1	248	0.0040	-1	c.164 others(5): Show c.1645delT	p.Cys others(5): Show p.Cys549fs	ARSH	ENSG00000205667.3	transcript	ENST00000381130.3	protein_coding	9/9	1712/2482	1645/1689	549/562		chrX	TogoVar
ARSL_chrX_2929521_2969341	2934866	A A	AG AG	frameshift_variant frameshift_variant	HIGH	HG01496.hp1 HG01496.hp1	a0009 a0009	a0009c0018 a0009c0018	a0009c0018t0003 a0009c0018t0003	a0009c0018t0003g0315 a0009c0018t0003g0315	1	328	0.0031	1	c.173 others(5): Show c.1735dupC	p.Leu others(5): Show p.Leu579fs	ARSL	ENSG00000157399.17	transcript	ENST00000381134.9	protein_coding	11/11	1873/2219	1735/1770	579/589		chrX	TogoVar
ARSL_chrX_2929521_2969341	2934885	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA18972.hp1 NA18972.hp1	a0011 a0011	a0011c0017 a0011c0017	a0011c0017t0011 a0011c0017t0011	a0011c0017t0011g0268 a0011c0017t0011g0268	1	328	0.0031	1	c.171 others(5): Show c.1716dupC	p.Cys others(5): Show p.Cys573fs	ARSL	ENSG00000157399.17	transcript	ENST00000381134.9	protein_coding	11/11	1854/2219	1716/1770	572/589		chrX	TogoVar
ARSL_chrX_2929521_2969341	2935094	TC TC	T T	frameshift_variant frameshift_variant	HIGH	HG02896.hp2 HG02896.hp2	a0008 a0008	a0008c0024 a0008c0024	a0008c0024t0005 a0008c0024t0005	a0008c0024t0005g0113 a0008c0024t0005g0113	1	328	0.0031	-1	c.150 others(5): Show c.1507delG	p.Glu others(5): Show p.Glu503fs	ARSL	ENSG00000157399.17	transcript	ENST00000381134.9	protein_coding	11/11	1645/2219	1507/1770	503/589		chrX	TogoVar
ARSL_chrX_2929521_2969341	2935112	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0010 a0010	a0010c0015 a0010c0015	a0010c0015t0013 a0010c0015t0013	a0010c0015t0013g0288 a0010c0015t0013g0288	1	328	0.0031	1	c.148 others(5): Show c.1489dupG	p.Val others(5): Show p.Val497fs	ARSL	ENSG00000157399.17	transcript	ENST00000381134.9	protein_coding	11/11	1627/2219	1489/1770	497/589		chrX	TogoVar
ARSL_chrX_2929521_2969341	2935169	TG TG	T T	frameshift_variant frameshift_variant	HIGH	HG02896.hp2 HG02896.hp2	a0008 a0008	a0008c0024 a0008c0024	a0008c0024t0005 a0008c0024t0005	a0008c0024t0005g0113 a0008c0024t0005g0113	1	328	0.0031	-1	c.143 others(5): Show c.1432delC	p.His others(5): Show p.His478fs	ARSL	ENSG00000157399.17	transcript	ENST00000381134.9	protein_coding	11/11	1570/2219	1432/1770	478/589		chrX	TogoVar
ARSL_chrX_2929521_2969341	2935184	G G	GT GT	frameshift_variant frameshift_variant	HIGH	HG02896.hp2 HG02896.hp2	a0008 a0008	a0008c0024 a0008c0024	a0008c0024t0005 a0008c0024t0005	a0008c0024t0005g0113 a0008c0024t0005g0113	1	328	0.0031	1	c.141 others(5): Show c.1417dupA	p.Thr others(5): Show p.Thr473fs	ARSL	ENSG00000157399.17	transcript	ENST00000381134.9	protein_coding	11/11	1555/2219	1417/1770	473/589		chrX	TogoVar
ARSL_chrX_2929521_2969341	2943085	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA19006.hp1 NA19006.hp1	a0012 a0012	a0012c0020 a0012c0020	a0012c0020t0001 a0012c0020t0001	a0012c0020t0001g0251 a0012c0020t0001g0251	1	328	0.0031	1	c.110 others(10): Show c.1105_1106insT	p.Gly others(5): Show p.Gly369fs	ARSL	ENSG00000157399.17	transcript	ENST00000381134.9	protein_coding	8/11	1243/2219	1105/1770	369/589		chrX	TogoVar
ARSL_chrX_2929521_2969341	2949311	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19060.hp1 NA19060.hp1	a0013 a0013	a0013c0025 a0013c0025	a0013c0025t0001 a0013c0025t0001	a0013c0025t0001g0181 a0013c0025t0001g0181	1	328	0.0031	-1	c.846 others(4): Show c.846delT	p.Leu others(5): Show p.Leu283fs	ARSL	ENSG00000157399.17	transcript	ENST00000381134.9	protein_coding	6/11	984/2219	846/1770	282/589		chrX	TogoVar
ARSL_chrX_2929521_2969341	2949344	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA19060.hp1 NA19060.hp1	a0013 a0013	a0013c0025 a0013c0025	a0013c0025t0001 a0013c0025t0001	a0013c0025t0001g0181 a0013c0025t0001g0181	1	328	0.0031	1	c.813 others(4): Show c.813dupG	p.Thr others(5): Show p.Thr272fs	ARSL	ENSG00000157399.17	transcript	ENST00000381134.9	protein_coding	6/11	951/2219	813/1770	271/589		chrX	TogoVar
ARSL_chrX_2929521_2969341	2949492	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA19060.hp1 NA19060.hp1	a0013 a0013	a0013c0025 a0013c0025	a0013c0025t0001 a0013c0025t0001	a0013c0025t0001g0181 a0013c0025t0001g0181	1	328	0.0031	1	c.665 others(8): Show c.665_666insA	p.Ser others(5): Show p.Ser223fs	ARSL	ENSG00000157399.17	transcript	ENST00000381134.9	protein_coding	6/11	803/2219	665/1770	222/589		chrX	TogoVar
ARSL_chrX_2929521_2969341	2949722	AT AT	A A	frameshift_variant frameshift_variant	HIGH	NA19060.hp1 NA19060.hp1	a0013 a0013	a0013c0025 a0013c0025	a0013c0025t0001 a0013c0025t0001	a0013c0025t0001g0181 a0013c0025t0001g0181	1	328	0.0031	-1	c.435 others(4): Show c.435delA	p.Lys others(5): Show p.Lys145fs	ARSL	ENSG00000157399.17	transcript	ENST00000381134.9	protein_coding	6/11	573/2219	435/1770	145/589		chrX	TogoVar
ARX_chrX_24998694_25020965	25013028	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19082.hp1 NA19082.hp1	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0015 a0004c0005t0015	a0004c0005t0015g0038 a0004c0005t0015g0038	1	300	0.0033	-1	c.966 others(4): Show c.966delG	p.Leu others(5): Show p.Leu323fs	ARX	ENSG00000004848.8	transcript	ENST00000379044.5	protein_coding	2/5	1194/2893	966/1689	322/562		chrX	TogoVar
ARX_chrX_24998694_25020965	25013132	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA19082.hp1 NA19082.hp1	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0015 a0004c0005t0015	a0004c0005t0015g0038 a0004c0005t0015g0038	1	300	0.0033	-1	c.862 others(4): Show c.862delG	p.Glu others(5): Show p.Glu288fs	ARX	ENSG00000004848.8	transcript	ENST00000379044.5	protein_coding	2/5	1090/2893	862/1689	288/562		chrX	TogoVar
ARX_chrX_24998694_25020965	25013440	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19089.hp1 NA19089.hp1	a0002 a0002	a0002c0003 a0002c0003	a0002c0003t0006 a0002c0003t0006	a0002c0003t0006g0031 a0002c0003t0006g0031	1	300	0.0033	1	c.554 others(4): Show c.554dupC	p.Pro others(5): Show p.Pro186fs	ARX	ENSG00000004848.8	transcript	ENST00000379044.5	protein_coding	2/5	782/2893	554/1689	185/562		chrX	TogoVar
ARX_chrX_24998694_25020965	25013536	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18964.hp2 NA18964.hp2	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0001 a0003c0004t0001	a0003c0004t0001g0097 a0003c0004t0001g0097	1	300	0.0033	1	c.458 others(8): Show c.458_459insG	p.Ala others(5): Show p.Ala154fs	ARX	ENSG00000004848.8	transcript	ENST00000379044.5	protein_coding	2/5	686/2893	458/1689	153/562		chrX	TogoVar
ARX_chrX_24998694_25020965	25013542	C C	CA CA	frameshift_variant frameshift_variant	HIGH	NA19089.hp1 NA19089.hp1	a0002 a0002	a0002c0003 a0002c0003	a0002c0003t0006 a0002c0003t0006	a0002c0003t0006g0031 a0002c0003t0006g0031	1	300	0.0033	1	c.452 others(8): Show c.452_453insT	p.Ala others(5): Show p.Ala152fs	ARX	ENSG00000004848.8	transcript	ENST00000379044.5	protein_coding	2/5	680/2893	452/1689	151/562		chrX	TogoVar
ARX_chrX_24998694_25020965	25013578	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA19082.hp1 NA19082.hp1	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0015 a0004c0005t0015	a0004c0005t0015g0038 a0004c0005t0015g0038	1	300	0.0033	1	c.416 others(4): Show c.416dupC	p.Asp others(5): Show p.Asp140fs	ARX	ENSG00000004848.8	transcript	ENST00000379044.5	protein_coding	2/5	644/2893	416/1689	139/562		chrX	TogoVar
ARX_chrX_24998694_25020965	25013613	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19082.hp1 NA19082.hp1	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0015 a0004c0005t0015	a0004c0005t0015g0038 a0004c0005t0015g0038	1	300	0.0033	1	c.381 others(4): Show c.381dupG	p.Pro others(5): Show p.Pro128fs	ARX	ENSG00000004848.8	transcript	ENST00000379044.5	protein_coding	2/5	609/2893	381/1689	127/562		chrX	TogoVar
ARX_chrX_24998694_25020965	25013654	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19089.hp1 NA19089.hp1	a0002 a0002	a0002c0003 a0002c0003	a0002c0003t0006 a0002c0003t0006	a0002c0003t0006g0031 a0002c0003t0006g0031	1	300	0.0033	-1	c.340 others(4): Show c.340delG	p.Ala others(5): Show p.Ala114fs	ARX	ENSG00000004848.8	transcript	ENST00000379044.5	protein_coding	2/5	568/2893	340/1689	114/562		chrX	TogoVar
ARX_chrX_24998694_25020965	25013745	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19089.hp1 NA19089.hp1	a0002 a0002	a0002c0003 a0002c0003	a0002c0003t0006 a0002c0003t0006	a0002c0003t0006g0031 a0002c0003t0006g0031	1	300	0.0033	1	c.249 others(4): Show c.249dupC	p.Lys others(4): Show p.Lys84fs	ARX	ENSG00000004848.8	transcript	ENST00000379044.5	protein_coding	2/5	477/2893	249/1689	83/562		chrX	TogoVar
ARX_chrX_24998694_25020965	25013773	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA19082.hp1 NA19082.hp1	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0015 a0004c0005t0015	a0004c0005t0015g0038 a0004c0005t0015g0038	1	300	0.0033	-1	c.221 others(4): Show c.221delC	p.Pro others(4): Show p.Pro74fs	ARX	ENSG00000004848.8	transcript	ENST00000379044.5	protein_coding	2/5	449/2893	221/1689	74/562		chrX	TogoVar
ARX_chrX_24998694_25020965	25015695	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA19089.hp1 NA19089.hp1	a0002 a0002	a0002c0003 a0002c0003	a0002c0003t0006 a0002c0003t0006	a0002c0003t0006g0031 a0002c0003t0006g0031	1	300	0.0033	-1	c.42d others(3): Show c.42delC	p.Glu others(4): Show p.Glu15fs	ARX	ENSG00000004848.8	transcript	ENST00000379044.5	protein_coding	1/5	270/2893	42/1689	14/562		chrX	TogoVar
ARX_chrX_24998694_25020965	25015711	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19089.hp1 NA19089.hp1	a0002 a0002	a0002c0003 a0002c0003	a0002c0003t0006 a0002c0003t0006	a0002c0003t0006g0031 a0002c0003t0006g0031	1	300	0.0033	-1	c.26d others(3): Show c.26delG	p.Gly others(3): Show p.Gly9fs	ARX	ENSG00000004848.8	transcript	ENST00000379044.5	protein_coding	1/5	254/2893	26/1689	9/562		chrX	TogoVar
AR_chrX_67539021_67735619	67545377	GCAGCAGC others(1): Show GCAGCAGCA	G G	frameshift_variant frameshift_variant	HIGH	HG02630.hp2 HG02630.hp2	a0071 a0071	a0071c0054 a0071c0054	a0071c0054t0018 a0071c0054t0018	a0071c0054t0018g0153 a0071c0054t0018g0153	1	193	0.0052	-8	c.232 others(15): Show c.232_239delCAGCAGCA	p.Gln others(4): Show p.Gln78fs	AR	ENSG00000169083.18	transcript	ENST00000374690.9	protein_coding	1/8	1358/10667	232/2763	78/920		chrX	TogoVar
AR_chrX_67539021_67735619	67546509	GGTGGTGG others(4): Show GGTGGTGGCGGC	G G	frameshift_variant frameshift_variant	HIGH	HG02818.hp2 HG02818.hp2	a0057 a0057	a0057c0062 a0057c0062	a0057c0062t0010 a0057c0062t0010	a0057c0062t0010g0185 a0057c0062t0010g0185	1	193	0.0052	-11	c.136 others(20): Show c.1365_1375delTGGTGGCGGCG	p.Gly others(5): Show p.Gly456fs	AR	ENSG00000169083.18	transcript	ENST00000374690.9	protein_coding	1/8	2491/10667	1365/2763	455/920	INFO_REALIGN_3_PRIME	chrX	TogoVar
AS3MT_chr10_102864470_102906899	102869497	TCCTGAGT others(29): Show TCCTGAGTCGCAGGCCGAGGAGACAGTGAGTGCGCGC	T T	frameshift_variant others(2): Show frameshift_variant start_lost splice_region_variant	HIGH	HG00099.hp1 HG00544.hp1 HG00597.hp1 others(170): Show HG00099.hp1 HG00544.hp1 HG00597.hp1 HG00609.hp1 HG00621.hp1 HG00639.hp1 HG00639.hp2 HG00642.hp1 HG00642.hp2 HG00673.hp1 HG00673.hp2 HG00735.hp2 HG00738.hp2 HG01069.hp1 HG01099.hp2 HG01109.hp2 HG01123.hp2 HG01167.hp1 HG01169.hp1 HG01243.hp2 HG01255.hp2 HG01257.hp2 HG01258.hp1 HG01358.hp2 HG01361.hp1 HG01361.hp2 HG01433.hp2 HG01496.hp1 HG01515.hp2 HG01517.hp1 HG01884.hp1 HG01934.hp1 HG01934.hp2 HG01943.hp1 HG01943.hp2 HG01952.hp1 HG01978.hp2 HG01981.hp1 HG02004.hp1 HG02004.hp2 HG02027.hp1 HG02055.hp1 HG02056.hp2 HG02071.hp2 HG02074.hp1 HG02083.hp1 HG02109.hp2 HG02129.hp1 HG02135.hp1 HG02135.hp2 HG02145.hp1 HG02155.hp1 HG02165.hp1 HG02165.hp2 HG02257.hp1 HG02257.hp2 HG02258.hp1 HG02258.hp2 HG02273.hp2 HG02280.hp1 HG02300.hp1 HG02300.hp2 HG02486.hp2 HG02523.hp2 HG02622.hp1 HG02622.hp2 HG02647.hp1 HG02647.hp2 HG02717.hp1 HG02735.hp2 HG02809.hp1 HG02809.hp2 HG02818.hp2 HG02896.hp2 HG02922.hp2 HG02970.hp2 HG02976.hp1 HG03017.hp1 HG03041.hp1 HG03098.hp2 HG03139.hp2 HG03225.hp1 HG03225.hp2 HG03486.hp1 HG03491.hp2 HG03516.hp1 HG03540.hp2 HG03688.hp2 HG03834.hp1 HG03834.hp2 HG03927.hp2 HG03942.hp1 HG04115.hp1 HG04228.hp1 NA18522.hp1 NA18612.hp2 NA18747.hp1 NA18939.hp2 NA18940.hp2 NA18941.hp1 NA18943.hp2 NA18945.hp2 NA18946.hp2 NA18947.hp1 NA18950.hp2 NA18951.hp2 NA18953.hp1 NA18954.hp2 NA18957.hp1 NA18960.hp1 NA18961.hp1 NA18962.hp1 NA18962.hp2 NA18963.hp1 NA18963.hp2 NA18965.hp1 NA18966.hp1 NA18968.hp2 NA18971.hp2 NA18973.hp1 NA18974.hp1 NA18974.hp2 NA18975.hp2 NA18977.hp2 NA18978.hp1 NA18982.hp1 NA18983.hp1 NA18986.hp1 NA18986.hp2 NA18989.hp1 NA18990.hp1 NA18991.hp2 NA18992.hp1 NA18994.hp1 NA18995.hp1 NA18997.hp2 NA19004.hp2 NA19005.hp1 NA19005.hp2 NA19009.hp1 NA19011.hp1 NA19030.hp1 NA19030.hp2 NA19043.hp2 NA19054.hp1 NA19055.hp1 NA19057.hp1 NA19057.hp2 NA19058.hp1 NA19058.hp2 NA19060.hp2 NA19064.hp2 NA19065.hp2 NA19067.hp1 NA19070.hp2 NA19072.hp2 NA19074.hp1 NA19074.hp2 NA19076.hp2 NA19077.hp1 NA19078.hp2 NA19082.hp2 NA19084.hp1 NA19087.hp1 NA19089.hp2 NA19090.hp1 NA20129.hp1 NA20300.hp2 NA20752.hp2 NA20805.hp1 NA20805.hp2 NA21309.hp1 NA21309.hp2	a0001 a0002 a0001 a0002	a0001c0001 a0001c0002 a0001c0003 others(6): Show a0001c0001 a0001c0002 a0001c0003 a0001c0004 a0001c0006 a0001c0007 a0001c0008 a0001c0011 a0002c0012	a0001c0001t0002 a0001c0001t0003 a0001c0001t0004 others(28): Show a0001c0001t0002 a0001c0001t0003 a0001c0001t0004 a0001c0001t0006 a0001c0001t0007 a0001c0001t0008 a0001c0001t0010 a0001c0001t0012 a0001c0001t0014 a0001c0001t0015 a0001c0001t0016 a0001c0001t0020 a0001c0001t0021 a0001c0001t0022 a0001c0001t0025 a0001c0001t0026 a0001c0001t0030 a0001c0001t0031 a0001c0001t0032 a0001c0002t0004 a0001c0002t0018 a0001c0002t0019 a0001c0002t0023 a0001c0002t0024 a0001c0003t0004 a0001c0004t0007 a0001c0006t0006 a0001c0007t0004 a0001c0008t0003 a0001c0011t0002 a0002c0012t0006	a0001c0001t0002g0002 a0001c0001t0002g0003 a0001c0001t0002g0007 others(163): Show a0001c0001t0002g0002 a0001c0001t0002g0003 a0001c0001t0002g0007 a0001c0001t0002g0008 a0001c0001t0002g0009 a0001c0001t0002g0060 a0001c0001t0002g0103 a0001c0001t0002g0104 a0001c0001t0002g0105 a0001c0001t0002g0108 a0001c0001t0002g0109 a0001c0001t0002g0110 a0001c0001t0002g0111 a0001c0001t0002g0112 a0001c0001t0002g0113 a0001c0001t0002g0119 a0001c0001t0002g0122 a0001c0001t0002g0125 a0001c0001t0002g0126 a0001c0001t0002g0127 a0001c0001t0002g0128 a0001c0001t0002g0133 a0001c0001t0002g0135 a0001c0001t0002g0136 a0001c0001t0002g0137 a0001c0001t0002g0139 a0001c0001t0002g0140 a0001c0001t0002g0141 a0001c0001t0002g0143 a0001c0001t0002g0144 a0001c0001t0002g0145 a0001c0001t0002g0147 a0001c0001t0002g0148 a0001c0001t0002g0149 a0001c0001t0002g0150 a0001c0001t0002g0153 a0001c0001t0002g0154 a0001c0001t0002g0155 a0001c0001t0002g0156 a0001c0001t0002g0157 a0001c0001t0002g0158 a0001c0001t0002g0159 a0001c0001t0002g0160 a0001c0001t0002g0161 a0001c0001t0003g0001 a0001c0001t0003g0004 a0001c0001t0003g0005 a0001c0001t0003g0062 a0001c0001t0003g0063 a0001c0001t0003g0064 a0001c0001t0003g0065 a0001c0001t0003g0066 a0001c0001t0003g0067 a0001c0001t0003g0068 a0001c0001t0003g0069 a0001c0001t0003g0071 a0001c0001t0003g0072 a0001c0001t0003g0074 a0001c0001t0003g0075 a0001c0001t0003g0076 a0001c0001t0003g0077 a0001c0001t0003g0078 a0001c0001t0003g0080 a0001c0001t0003g0081 a0001c0001t0003g0082 a0001c0001t0003g0083 a0001c0001t0003g0084 a0001c0001t0003g0085 a0001c0001t0003g0106 a0001c0001t0003g0177 a0001c0001t0004g0027 a0001c0001t0006g0015 a0001c0001t0006g0102 a0001c0001t0006g0163 a0001c0001t0006g0164 a0001c0001t0006g0165 a0001c0001t0006g0166 a0001c0001t0006g0169 a0001c0001t0006g0170 a0001c0001t0006g0172 a0001c0001t0006g0173 a0001c0001t0006g0174 a0001c0001t0006g0175 a0001c0001t0007g0002 a0001c0001t0007g0107 a0001c0001t0007g0114 a0001c0001t0007g0115 a0001c0001t0007g0116 a0001c0001t0007g0117 a0001c0001t0007g0118 a0001c0001t0007g0120 a0001c0001t0007g0124 a0001c0001t0007g0129 a0001c0001t0007g0130 a0001c0001t0007g0138 a0001c0001t0008g0034 a0001c0001t0008g0035 a0001c0001t0008g0042 a0001c0001t0008g0043 a0001c0001t0008g0045 a0001c0001t0008g0048 a0001c0001t0008g0049 a0001c0001t0008g0050 a0001c0001t0008g0051 a0001c0001t0010g0070 a0001c0001t0010g0121 a0001c0001t0010g0146 a0001c0001t0010g0256 a0001c0001t0010g0261 a0001c0001t0010g0267 a0001c0001t0010g0269 a0001c0001t0012g0002 a0001c0001t0012g0003 a0001c0001t0012g0008 a0001c0001t0012g0123 a0001c0001t0012g0134 a0001c0001t0012g0151 a0001c0001t0014g0001 a0001c0001t0014g0061 a0001c0001t0014g0079 a0001c0001t0015g0059 a0001c0001t0015g0142 a0001c0001t0015g0152 a0001c0001t0016g0044 a0001c0001t0016g0052 a0001c0001t0020g0168 a0001c0001t0021g0171 a0001c0001t0022g0016 a0001c0001t0025g0046 a0001c0001t0026g0047 a0001c0001t0030g0005 a0001c0001t0031g0268 a0001c0001t0032g0131 a0001c0002t0004g0017 a0001c0002t0004g0018 a0001c0002t0004g0019 a0001c0002t0004g0021 a0001c0002t0004g0022 a0001c0002t0004g0023 a0001c0002t0004g0024 a0001c0002t0004g0025 a0001c0002t0004g0028 a0001c0002t0004g0029 a0001c0002t0004g0032 a0001c0002t0004g0033 a0001c0002t0004g0037 a0001c0002t0004g0038 a0001c0002t0004g0039 a0001c0002t0004g0040 a0001c0002t0004g0041 a0001c0002t0004g0053 a0001c0002t0004g0054 a0001c0002t0004g0055 a0001c0002t0004g0057 a0001c0002t0004g0058 a0001c0002t0018g0030 a0001c0002t0019g0031 a0001c0002t0023g0026 a0001c0002t0024g0056 a0001c0003t0004g0036 a0001c0004t0007g0162 a0001c0006t0006g0176 a0001c0007t0004g0020 a0001c0008t0003g0073 a0001c0011t0002g0132 a0002c0012t0006g0167	173	362	0.4779	-36	c.-19 others(44): Show c.-19_1+16delAGTCGCAGGCCGAGGAGACAGTGAGTGCGCGCCCTG	p.Met others(3): Show p.Met1fs	AS3MT	ENSG00000214435.9	transcript	ENST00000369880.8	protein_coding	1/11	105/2450	1/1128	1/375	INFO_REALIGN_3_PRIME	chr10	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)