Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
ASB11_chrX_15276697_15320640	15315537	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0008 a0008	a0008c0009 a0008c0009	a0008c0009t0002 a0008c0009t0002	a0008c0009t0002g0263 a0008c0009t0002g0263	1	306	0.0033	1	c.68d others(3): Show c.68dupT	p.Phe others(4): Show p.Phe24fs	ASB11	ENSG00000165192.14	transcript	ENST00000480796.6	protein_coding	1/7	103/2815	68/972	23/323		chrX	TogoVar
ASB6_chr9_129629605_129647151	129637966	AGAAGTGG others(48): Show AGAAGTGGAGGGCCTGGATCTTTTCCGCCAGGCTGCCCACAGGGTGGATA TCGAAG	A A	frameshift_variant frameshift_variant	HIGH	HG02922.hp1 HG02922.hp1	a0004 a0004	a0004c0010 a0004c0010	a0004c0010t0003 a0004c0010t0003	a0004c0010t0003g0036 a0004c0010t0003g0036	1	422	0.0024	-55	c.103 others(64): Show c.1035_1089delCTTCGATATCCACCCTGTGGGCAGCCTGGCGGAAAA GATCCAGGCCCTCCACTTC	p.Phe others(5): Show p.Phe346fs	ASB6	ENSG00000148331.12	transcript	ENST00000277458.5	protein_coding	6/6	1241/4603	1035/1266	345/421		chr9	TogoVar
ASH2L_chr8_38100529_38145080	38119321	AGCAGGAT others(4): Show AGCAGGATGGAG	A A	frameshift_variant frameshift_variant	HIGH	NA20129.hp2 NA20129.hp2	a0005 a0005	a0005c0009 a0005c0009	a0005c0009t0001 a0005c0009t0001	a0005c0009t0001g0212 a0005c0009t0001g0212	1	330	0.0030	-11	c.907 others(18): Show c.907_917delCAGGATGGAGG	p.Gln others(5): Show p.Gln303fs	ASH2L	ENSG00000129691.16	transcript	ENST00000343823.11	protein_coding	9/16	929/2918	907/1887	303/628	INFO_REALIGN_3_PRIME	chr8	TogoVar
ASMTL_chrX_1398139_1457909	1403270	CA CA	C C	frameshift_variant others(1): Show frameshift_variant stop_lost	HIGH	HG00323.hp2 HG00733.hp1 HG01070.hp2 others(8): Show HG00323.hp2 HG00733.hp1 HG01070.hp2 HG01071.hp1 HG01257.hp1 HG02004.hp2 HG02165.hp2 HG02615.hp1 HG02683.hp1 NA18971.hp2 NA19081.hp2	a0000 a0000	a0000c0007 a0000c0030 a0000c0039 others(1): Show a0000c0007 a0000c0030 a0000c0039 a0000c0043	a0000c0007t0001 a0000c0030t0001 a0000c0039t0001 others(1): Show a0000c0007t0001 a0000c0030t0001 a0000c0039t0001 a0000c0043t0001	a0000c0007t0001g0033 a0000c0007t0001g0034 a0000c0007t0001g0043 others(8): Show a0000c0007t0001g0033 a0000c0007t0001g0034 a0000c0007t0001g0043 a0000c0007t0001g0044 a0000c0007t0001g0061 a0000c0007t0001g0086 a0000c0007t0001g0092 a0000c0007t0001g0126 a0000c0030t0001g0026 a0000c0039t0001g0148 a0000c0043t0001g0069	11	185	0.0595	-1	c.186 others(5): Show c.1864delT	p.Ter others(5): Show p.Ter622fs	ASMTL	ENSG00000169093.16	transcript	ENST00000381317.9	protein_coding	13/13	1933/2065	1864/1866	622/621		chrX	TogoVar
ASMTL_chrX_1398139_1457909	1421689	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA18992.hp1 NA18992.hp1	a0018 a0018	a0018c0032 a0018c0032	a0018c0032t0001 a0018c0032t0001	a0018c0032t0001g0105 a0018c0032t0001g0105	1	185	0.0054	1	c.121 others(5): Show c.1213dupG	p.Ala others(5): Show p.Ala405fs	ASMTL	ENSG00000169093.16	transcript	ENST00000381317.9	protein_coding	9/13	1282/2065	1213/1866	405/621		chrX	TogoVar
ASMTL_chrX_1398139_1457909	1427898	C C	CA CA	frameshift_variant frameshift_variant	HIGH	HG01192.hp2 HG01192.hp2	a0019 a0019	a0019c0021 a0019c0021	a0019c0021t0001 a0019c0021t0001	a0019c0021t0001g0101 a0019c0021t0001g0101	1	185	0.0054	1	c.732 others(8): Show c.732_733insT	p.Gly others(5): Show p.Gly245fs	ASMTL	ENSG00000169093.16	transcript	ENST00000381317.9	protein_coding	7/13	801/2065	732/1866	244/621		chrX	TogoVar
ASMTL_chrX_1398139_1457909	1427989	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG01496.hp2 HG01496.hp2	a0009 a0009	a0009c0020 a0009c0020	a0009c0020t0001 a0009c0020t0001	a0009c0020t0001g0063 a0009c0020t0001g0063	1	185	0.0054	1	c.641 others(4): Show c.641dupC	p.Pro others(5): Show p.Pro215fs	ASMTL	ENSG00000169093.16	transcript	ENST00000381317.9	protein_coding	7/13	710/2065	641/1866	214/621		chrX	TogoVar
ASMTL_chrX_1398139_1457909	1439126	C C	CG CG	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0021 a0021	a0021c0019 a0021c0019	a0021c0019t0001 a0021c0019t0001	a0021c0019t0001g0067 a0021c0019t0001g0067	1	185	0.0054	1	c.243 others(4): Show c.243dupC	p.Asp others(4): Show p.Asp82fs	ASMTL	ENSG00000169093.16	transcript	ENST00000381317.9	protein_coding	3/13	312/2065	243/1866	81/621		chrX	TogoVar
ASMTL_chrX_1398139_1457909	1452816	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18965.hp1 NA18965.hp1	a0022 a0022	a0022c0046 a0022c0046	a0022c0046t0004 a0022c0046t0004	a0022c0046t0004g0184 a0022c0046t0004g0184	1	185	0.0054	-1	c.24d others(3): Show c.24delG	p.Lys others(3): Show p.Lys9fs	ASMTL	ENSG00000169093.16	transcript	ENST00000381317.9	protein_coding	1/13	93/2065	24/1866	8/621		chrX	TogoVar
ASMTL_chrX_1398139_1457909	1452826	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA18965.hp1 NA18965.hp1	a0022 a0022	a0022c0046 a0022c0046	a0022c0046t0004 a0022c0046t0004	a0022c0046t0004g0184 a0022c0046t0004g0184	1	185	0.0054	-1	c.14d others(3): Show c.14delC	p.Pro others(3): Show p.Pro5fs	ASMTL	ENSG00000169093.16	transcript	ENST00000381317.9	protein_coding	1/13	83/2065	14/1866	5/621		chrX	TogoVar
ASMT_chrX_1610059_1648081	1623195	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA18988.hp1 NA18988.hp1	a0014 a0014	a0014c0018 a0014c0018	a0014c0018t0001 a0014c0018t0001	a0014c0018t0001g0060 a0014c0018t0001g0060	1	223	0.0045	-1	c.130 others(4): Show c.130delC	p.Leu others(4): Show p.Leu44fs	ASMT	ENSG00000196433.13	transcript	ENST00000381241.9	protein_coding	2/9	271/1330	130/1122	44/373	INFO_REALIGN_3_PRIME	chrX	TogoVar
ASMT_chrX_1610059_1648081	1623209	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG02523.hp1 HG02523.hp1	a0013 a0013	a0013c0017 a0013c0017	a0013c0017t0001 a0013c0017t0001	a0013c0017t0001g0111 a0013c0017t0001g0111	1	223	0.0045	1	c.142 others(4): Show c.142dupG	p.Ala others(4): Show p.Ala48fs	ASMT	ENSG00000196433.13	transcript	ENST00000381241.9	protein_coding	2/9	284/1330	143/1122	48/373	INFO_REALIGN_3_PRIME	chrX	TogoVar
ASMT_chrX_1610059_1648081	1624388	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA19082.hp1 NA19082.hp1	a0012 a0012	a0012c0007 a0012c0007	a0012c0007t0001 a0012c0007t0001	a0012c0007t0001g0036 a0012c0007t0001g0036	1	223	0.0045	1	c.365 others(4): Show c.365dupA	p.Asp others(5): Show p.Asp122fs	ASMT	ENSG00000196433.13	transcript	ENST00000381241.9	protein_coding	3/9	507/1330	366/1122	122/373	INFO_REALIGN_3_PRIME	chrX	TogoVar
ASMT_chrX_1610059_1648081	1627752	CT CT	C C	frameshift_variant frameshift_variant	HIGH	HG02523.hp2 HG02523.hp2	a0011 a0011	a0011c0008 a0011c0008	a0011c0008t0001 a0011c0008t0001	a0011c0008t0001g0034 a0011c0008t0001g0034	1	223	0.0045	-1	c.429 others(4): Show c.429delT	p.Phe others(5): Show p.Phe143fs	ASMT	ENSG00000196433.13	transcript	ENST00000381241.9	protein_coding	4/9	570/1330	429/1122	143/373	INFO_REALIGN_3_PRIME	chrX	TogoVar
ASMT_chrX_1610059_1648081	1632721	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA18939.hp1 NA18939.hp1	a0008 a0008	a0008c0013 a0008c0013	a0008c0013t0001 a0008c0013t0001	a0008c0013t0001g0101 a0008c0013t0001g0101	1	223	0.0045	1	c.583 others(4): Show c.583dupA	p.Thr others(5): Show p.Thr195fs	ASMT	ENSG00000196433.13	transcript	ENST00000381241.9	protein_coding	6/9	725/1330	584/1122	195/373	INFO_REALIGN_3_PRIME	chrX	TogoVar
ASMT_chrX_1610059_1648081	1632770	G G	GT GT	frameshift_variant frameshift_variant	HIGH	NA18939.hp1 NA18939.hp1	a0008 a0008	a0008c0013 a0008c0013	a0008c0013t0001 a0008c0013t0001	a0008c0013t0001g0101 a0008c0013t0001g0101	1	223	0.0045	1	c.629 others(8): Show c.629_630insT	p.Val others(5): Show p.Val211fs	ASMT	ENSG00000196433.13	transcript	ENST00000381241.9	protein_coding	6/9	771/1330	630/1122	210/373		chrX	TogoVar
ASMT_chrX_1610059_1648081	1633238	GGCAAAGC others(16): Show GGCAAAGCAGCACTTCTCATTCCA	G G	frameshift_variant frameshift_variant	HIGH	NA18963.hp1 NA18963.hp1	a0007 a0007	a0007c0012 a0007c0012	a0007c0012t0001 a0007c0012t0001	a0007c0012t0001g0109 a0007c0012t0001g0109	1	223	0.0045	-23	c.737 others(30): Show c.737_759delCAAAGCAGCACTTCTCATTCCAG	p.Ala others(5): Show p.Ala246fs	ASMT	ENSG00000196433.13	transcript	ENST00000381241.9	protein_coding	7/9	878/1330	737/1122	246/373	INFO_REALIGN_3_PRIME	chrX	TogoVar
ASMT_chrX_1610059_1648081	1633256	AT AT	A A	frameshift_variant frameshift_variant	HIGH	NA18939.hp1 NA18939.hp1	a0008 a0008	a0008c0013 a0008c0013	a0008c0013t0001 a0008c0013t0001	a0008c0013t0001g0101 a0008c0013t0001g0101	1	223	0.0045	-1	c.755 others(4): Show c.755delT	p.Phe others(5): Show p.Phe252fs	ASMT	ENSG00000196433.13	transcript	ENST00000381241.9	protein_coding	7/9	896/1330	755/1122	252/373	INFO_REALIGN_3_PRIME	chrX	TogoVar
ASMT_chrX_1610059_1648081	1636536	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA19072.hp2 NA19072.hp2	a0010 a0010	a0010c0015 a0010c0015	a0010c0015t0002 a0010c0015t0002	a0010c0015t0002g0179 a0010c0015t0002g0179	1	223	0.0045	-1	c.888 others(4): Show c.888delG	p.Ile others(5): Show p.Ile297fs	ASMT	ENSG00000196433.13	transcript	ENST00000381241.9	protein_coding	8/9	1029/1330	888/1122	296/373	INFO_REALIGN_3_PRIME	chrX	TogoVar
ASTL_chr2_96117818_96143502	96123863	AT AT	A A	frameshift_variant frameshift_variant	HIGH	HG01884.hp1 HG02109.hp2 HG02257.hp1 others(7): Show HG01884.hp1 HG02109.hp2 HG02257.hp1 HG02965.hp2 HG03130.hp2 HG03139.hp1 HG03195.hp1 HG03516.hp2 HG03579.hp2 NA20129.hp1	a0000 a0000	a0000c0005 a0000c0005	a0000c0005t0001 a0000c0005t0001	a0000c0005t0001g0008 a0000c0005t0001g0008	10	396	0.0253	-1	c.128 others(5): Show c.1282delA	p.Met others(5): Show p.Met428fs	ASTL	ENSG00000188886.4	transcript	ENST00000342380.3	protein_coding	9/9	1348/2394	1282/1296	428/431		chr2	TogoVar
ATAD3B_chr1_1466765_1502848	1472036	ACCCCACC others(36): Show ACCCCACCGGCCTGGAGCGCGCCGCCAAGGCGGCGCGCGAGCTG	A A	frameshift_variant frameshift_variant	HIGH	NA18959.hp2 NA18959.hp2	a0027 a0027	a0027c0037 a0027c0037	a0027c0037t0001 a0027c0037t0001	a0027c0037t0001g0003 a0027c0037t0001g0003	1	276	0.0036	-43	c.153 others(50): Show c.153_195delCCCCACCGGCCTGGAGCGCGCCGCCAAGGCGGCGCGCG AGCTG	p.Asp others(4): Show p.Asp51fs	ATAD3B	ENSG00000160072.20	transcript	ENST00000673477.1	protein_coding	1/16	273/4098	153/1947	51/648		chr1	TogoVar
ATAT1_chr6_30621874_30651821	30642841	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG00738.hp1 HG00741.hp2 HG01109.hp2 others(13): Show HG00738.hp1 HG00741.hp2 HG01109.hp2 HG01175.hp1 HG01496.hp1 HG01978.hp1 HG01978.hp2 HG02056.hp2 HG02293.hp2 HG02523.hp1 HG03927.hp1 NA18985.hp2 NA19002.hp2 NA19030.hp1 NA19067.hp1 NA19090.hp2	a0002 a0002	a0002c0003 a0002c0005 a0002c0003 a0002c0005	a0002c0003t0001 a0002c0005t0001 a0002c0003t0001 a0002c0005t0001	a0002c0003t0001g0001 a0002c0003t0001g0002 a0002c0003t0001g0004 others(12): Show a0002c0003t0001g0001 a0002c0003t0001g0002 a0002c0003t0001g0004 a0002c0003t0001g0010 a0002c0003t0001g0017 a0002c0003t0001g0022 a0002c0003t0001g0042 a0002c0003t0001g0057 a0002c0003t0001g0112 a0002c0003t0001g0186 a0002c0003t0001g0201 a0002c0005t0001g0033 a0002c0005t0001g0060 a0002c0005t0001g0065 a0002c0005t0001g0071	16	405	0.0395	1	c.805 others(4): Show c.805dupC	p.Arg others(5): Show p.Arg269fs	ATAT1	ENSG00000137343.18	transcript	ENST00000376485.9	protein_coding	10/13	818/1456	806/1266	269/421	INFO_REALIGN_3_PRIME	chr6	TogoVar
ATG2A_chr11_64889546_64922209	64898769	T T	TCCCCATA others(4): Show TCCCCATACTAC	frameshift_variant frameshift_variant	HIGH	NA19058.hp1 NA19058.hp1	a0029 a0029	a0029c0045 a0029c0045	a0029c0045t0001 a0029c0045t0001	a0029c0045t0001g0183 a0029c0045t0001g0183	1	372	0.0027	11	c.453 others(20): Show c.4537_4538insGTAGTATGGGG	p.Glu others(6): Show p.Glu1513fs	ATG2A	ENSG00000110046.14	transcript	ENST00000377264.8	protein_coding	32/41	4611/6318	4537/5817	1513/1938		chr11	TogoVar
ATG2A_chr11_64889546_64922209	64913121	G G	GCTCTGGA others(7): Show GCTCTGGAGGCTCTT	frameshift_variant frameshift_variant	HIGH	NA18951.hp1 NA18951.hp1	a0019 a0019	a0019c0036 a0019c0036	a0019c0036t0001 a0019c0036t0001	a0019c0036t0001g0172 a0019c0036t0001g0172	1	372	0.0027	14	c.728 others(21): Show c.728_741dupAAGAGCCTCCAGAG	p.Pro others(5): Show p.Pro248fs	ATG2A	ENSG00000110046.14	transcript	ENST00000377264.8	protein_coding	6/41	815/6318	741/5817	247/1938		chr11	TogoVar
ATG9B_chr7_151010151_151029494	151018672	CCACGGCT others(49): Show CCACGGCTAGCACGTCCTCGTCGTAGACGGTGAGCACAAGCAGCGCGGCG AAGAGTG	C C	frameshift_variant frameshift_variant	HIGH	HG03516.hp1 HG03516.hp1	a0035 a0035	a0035c0027 a0035c0027	a0035c0027t0001 a0035c0027t0001	a0035c0027t0001g0068 a0035c0027t0001g0068	1	466	0.0022	-56	c.161 others(65): Show c.1610_1665delCACTCTTCGCCGCGCTGCTTGTGCTCACCGTCTACG ACGAGGACGTGCTAGCCGTG	p.Ala others(5): Show p.Ala537fs	ATG9B	ENSG00000181652.20	transcript	ENST00000639579.2	protein_coding	6/14	1736/3423	1610/2775	537/924		chr7	TogoVar
ATP11C_chrX_139721348_139938053	139762075	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA19067.hp1 NA19067.hp1	a0006 a0006	a0006c0006 a0006c0006	a0006c0006t0002 a0006c0006t0002	a0006c0006t0002g0037 a0006c0006t0002g0037	1	234	0.0043	-1	c.252 others(5): Show c.2525delC	p.Ala others(5): Show p.Ala842fs	ATP11C	ENSG00000101974.15	transcript	ENST00000682941.1	protein_coding	22/30	3536/7019	2525/3390	842/1129		chrX	TogoVar
ATP11C_chrX_139721348_139938053	139774777	C C	CT CT	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0005 a0005	a0005c0007 a0005c0007	a0005c0007t0001 a0005c0007t0001	a0005c0007t0001g0095 a0005c0007t0001g0095	1	234	0.0043	1	c.212 others(5): Show c.2128dupA	p.Arg others(5): Show p.Arg710fs	ATP11C	ENSG00000101974.15	transcript	ENST00000682941.1	protein_coding	19/30	3139/7019	2128/3390	710/1129		chrX	TogoVar
ATP1A1_chr1_116368244_116409774	116398906	AGTAAAAA others(16): Show AGTAAAAAATCTTGGTTTTCATAG	A A	frameshift_variant others(3): Show frameshift_variant splice_acceptor_variant splice_region_variant intron_variant	HIGH	HG02615.hp2 HG02615.hp2	a0001 a0001	a0001c0003 a0001c0003	a0001c0003t0002 a0001c0003t0002	a0001c0003t0002g0068 a0001c0003t0002g0068	1	336	0.0030	-23	c.229 others(35): Show c.2294-21_2295delAAAAAATCTTGGTTTTCATAGGT	p.Gly others(5): Show p.Gly765fs	ATP1A1	ENSG00000163399.16	transcript	ENST00000295598.10	protein_coding	17/23		2294/3072	765/1023	INFO_REALIGN_3_PRIME	chr1	TogoVar
ATP1B4_chrX_120357089_120388237	120366526	ATGATCCG ATGATCCG	A A	frameshift_variant others(1): Show frameshift_variant splice_region_variant	HIGH	NA18987.hp2 NA18987.hp2	a0008 a0008	a0008c0004 a0008c0004	a0008c0004t0001 a0008c0004t0001	a0008c0004t0001g0140 a0008c0004t0001g0140	1	353	0.0028	-7	c.66_ others(12): Show c.66_72delTGATCCG	p.Asp others(4): Show p.Asp22fs	ATP1B4	ENSG00000101892.12	transcript	ENST00000218008.8	protein_coding	2/8	146/4757	66/1074	22/357		chrX	TogoVar
ATP1B4_chrX_120357089_120388237	120366601	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA18987.hp2 NA18987.hp2	a0008 a0008	a0008c0004 a0008c0004	a0008c0004t0001 a0008c0004t0001	a0008c0004t0001g0140 a0008c0004t0001g0140	1	353	0.0028	1	c.142 others(4): Show c.142dupG	p.Val others(4): Show p.Val48fs	ATP1B4	ENSG00000101892.12	transcript	ENST00000218008.8	protein_coding	2/8	223/4757	143/1074	48/357	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP1B4_chrX_120357089_120388237	120366655	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA18987.hp2 NA18987.hp2	a0008 a0008	a0008c0004 a0008c0004	a0008c0004t0001 a0008c0004t0001	a0008c0004t0001g0140 a0008c0004t0001g0140	1	353	0.0028	-1	c.196 others(4): Show c.196delG	p.Glu others(4): Show p.Glu66fs	ATP1B4	ENSG00000101892.12	transcript	ENST00000218008.8	protein_coding	2/8	276/4757	196/1074	66/357	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP1B4_chrX_120357089_120388237	120366735	T T	TACCTGTG others(7): Show TACCTGTGGGATCCA	frameshift_variant frameshift_variant	HIGH	NA18987.hp2 NA18987.hp2	a0008 a0008	a0008c0004 a0008c0004	a0008c0004t0001 a0008c0004t0001	a0008c0004t0001g0140 a0008c0004t0001g0140	1	353	0.0028	14	c.275 others(21): Show c.275_288dupACCTGTGGGATCCA	p.Glu others(4): Show p.Glu97fs	ATP1B4	ENSG00000101892.12	transcript	ENST00000218008.8	protein_coding	2/8	369/4757	289/1074	97/357	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP1B4_chrX_120357089_120388237	120370742	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA18972.hp1 NA18972.hp1	a0004 a0004	a0004c0005 a0004c0005	a0004c0005t0001 a0004c0005t0001	a0004c0005t0001g0164 a0004c0005t0001g0164	1	353	0.0028	1	c.357 others(4): Show c.357dupC	p.Tyr others(5): Show p.Tyr120fs	ATP1B4	ENSG00000101892.12	transcript	ENST00000218008.8	protein_coding	3/8	438/4757	358/1074	120/357	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP1B4_chrX_120357089_120388237	120375395	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19087.hp2 NA19087.hp2	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0003 a0005c0008t0003	a0005c0008t0003g0124 a0005c0008t0003g0124	1	353	0.0028	-1	c.589 others(4): Show c.589delA	p.Met others(5): Show p.Met197fs	ATP1B4	ENSG00000101892.12	transcript	ENST00000218008.8	protein_coding	5/8	669/4757	589/1074	197/357	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP1B4_chrX_120357089_120388237	120375455	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19087.hp2 NA19087.hp2	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0003 a0005c0008t0003	a0005c0008t0003g0124 a0005c0008t0003g0124	1	353	0.0028	-1	c.647 others(4): Show c.647delA	p.Asp others(5): Show p.Asp216fs	ATP1B4	ENSG00000101892.12	transcript	ENST00000218008.8	protein_coding	5/8	727/4757	647/1074	216/357		chrX	TogoVar
ATP1B4_chrX_120357089_120388237	120375469	CCA CCA	C C	frameshift_variant frameshift_variant	HIGH	NA19087.hp2 NA19087.hp2	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0003 a0005c0008t0003	a0005c0008t0003g0124 a0005c0008t0003g0124	1	353	0.0028	-2	c.661 others(9): Show c.661_662delCA	p.Gln others(5): Show p.Gln221fs	ATP1B4	ENSG00000101892.12	transcript	ENST00000218008.8	protein_coding	5/8	741/4757	661/1074	221/357		chrX	TogoVar
ATP2A1_chr16_28873488_28909466	28902839	TCGAGGCC others(31): Show TCGAGGCCCCCGAGCCCATGACCATGGCCCTGTCCGTGC	T T	frameshift_variant frameshift_variant	HIGH	NA18948.hp2 NA18948.hp2	a0007 a0007	a0007c0012 a0007c0012	a0007c0012t0001 a0007c0012t0001	a0007c0012t0001g0227 a0007c0012t0001g0227	1	380	0.0026	-38	c.267 others(47): Show c.2673_2710delCGAGGCCCCCGAGCCCATGACCATGGCCCTGTCCGT GC	p.Glu others(5): Show p.Glu892fs	ATP2A1	ENSG00000196296.14	transcript	ENST00000395503.9	protein_coding	19/23	2857/3493	2673/2985	891/994		chr16	TogoVar
ATP2B3_chrX_153512642_153587929	153541373	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA18962.hp1 NA18962.hp1	a0007 a0007	a0007c0023 a0007c0023	a0007c0023t0001 a0007c0023t0001	a0007c0023t0001g0097 a0007c0023t0001g0097	1	267	0.0038	1	c.225 others(4): Show c.225dupC	p.Asn others(4): Show p.Asn76fs	ATP2B3	ENSG00000067842.19	transcript	ENST00000263519.5	protein_coding	4/22	706/6774	226/3663	76/1220	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP2B3_chrX_153512642_153587929	153541419	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18962.hp1 NA18962.hp1	a0007 a0007	a0007c0023 a0007c0023	a0007c0023t0001 a0007c0023t0001	a0007c0023t0001g0097 a0007c0023t0001g0097	1	267	0.0038	-1	c.275 others(4): Show c.275delC	p.Pro others(4): Show p.Pro92fs	ATP2B3	ENSG00000067842.19	transcript	ENST00000263519.5	protein_coding	4/22	755/6774	275/3663	92/1220	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP2B3_chrX_153512642_153587929	153541436	A A	AAACC AAACC	frameshift_variant frameshift_variant	HIGH	NA18962.hp1 NA18962.hp1	a0007 a0007	a0007c0023 a0007c0023	a0007c0023t0001 a0007c0023t0001	a0007c0023t0001g0097 a0007c0023t0001g0097	1	267	0.0038	4	c.287 others(11): Show c.287_288insACCA	p.Thr others(4): Show p.Thr97fs	ATP2B3	ENSG00000067842.19	transcript	ENST00000263519.5	protein_coding	4/22	768/6774	288/3663	96/1220	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP2B3_chrX_153512642_153587929	153541900	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA18962.hp1 NA18962.hp1	a0007 a0007	a0007c0023 a0007c0023	a0007c0023t0001 a0007c0023t0001	a0007c0023t0001g0097 a0007c0023t0001g0097	1	267	0.0038	-1	c.643 others(4): Show c.643delG	p.Asp others(5): Show p.Asp215fs	ATP2B3	ENSG00000067842.19	transcript	ENST00000263519.5	protein_coding	5/22	1123/6774	643/3663	215/1220	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP2B3_chrX_153512642_153587929	153541915	AG AG	A A	frameshift_variant frameshift_variant	HIGH	NA18962.hp1 NA18962.hp1	a0007 a0007	a0007c0023 a0007c0023	a0007c0023t0001 a0007c0023t0001	a0007c0023t0001g0097 a0007c0023t0001g0097	1	267	0.0038	-1	c.655 others(4): Show c.655delG	p.Val others(5): Show p.Val219fs	ATP2B3	ENSG00000067842.19	transcript	ENST00000263519.5	protein_coding	5/22	1135/6774	655/3663	219/1220	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP2B3_chrX_153512642_153587929	153550143	C C	CGT CGT	frameshift_variant frameshift_variant	HIGH	NA19077.hp2 NA19077.hp2	a0004 a0004	a0004c0019 a0004c0019	a0004c0019t0001 a0004c0019t0001	a0004c0019t0001g0114 a0004c0019t0001g0114	1	267	0.0038	2	c.168 others(11): Show c.1682_1683dupTG	p.Arg others(5): Show p.Arg562fs	ATP2B3	ENSG00000067842.19	transcript	ENST00000263519.5	protein_coding	12/22	2164/6774	1684/3663	562/1220	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP2B3_chrX_153512642_153587929	153553088	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0005 a0005	a0005c0012 a0005c0012	a0005c0012t0044 a0005c0012t0044	a0005c0012t0044g0224 a0005c0012t0044g0224	1	267	0.0038	1	c.187 others(5): Show c.1879dupC	p.Arg others(5): Show p.Arg627fs	ATP2B3	ENSG00000067842.19	transcript	ENST00000263519.5	protein_coding	13/22	2360/6774	1880/3663	627/1220	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP2B3_chrX_153512642_153587929	153580055	C C	CTTCAT CTTCAT	frameshift_variant frameshift_variant	HIGH	NA18982.hp1 NA18982.hp1	a0006 a0006	a0006c0014 a0006c0014	a0006c0014t0036 a0006c0014t0036	a0006c0014t0036g0001 a0006c0014t0036g0001	1	267	0.0038	5	c.342 others(14): Show c.3421_3425dupTTCAT	p.Met others(6): Show p.Met1142fs	ATP2B3	ENSG00000067842.19	transcript	ENST00000263519.5	protein_coding	22/22	3906/6774	3426/3663	1142/1220	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP2B3_chrX_153512642_153587929	153580102	TC TC	T T	frameshift_variant frameshift_variant	HIGH	HG02976.hp2 HG02976.hp2	a0000 a0000	a0000c0008 a0000c0008	a0000c0008t0021 a0000c0008t0021	a0000c0008t0021g0228 a0000c0008t0021g0228	1	267	0.0038	-1	c.347 others(5): Show c.3470delC	p.Pro others(6): Show p.Pro1157fs	ATP2B3	ENSG00000067842.19	transcript	ENST00000263519.5	protein_coding	22/22	3950/6774	3470/3663	1157/1220	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP2B3_chrX_153512642_153587929	153580149	CG CG	C C	frameshift_variant frameshift_variant	HIGH	HG02976.hp2 HG02976.hp2	a0000 a0000	a0000c0008 a0000c0008	a0000c0008t0021 a0000c0008t0021	a0000c0008t0021g0228 a0000c0008t0021g0228	1	267	0.0038	-1	c.351 others(5): Show c.3517delG	p.Ala others(6): Show p.Ala1173fs	ATP2B3	ENSG00000067842.19	transcript	ENST00000263519.5	protein_coding	22/22	3997/6774	3517/3663	1173/1220	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP2B3_chrX_153512642_153587929	153580152	G G	GC GC	frameshift_variant frameshift_variant	HIGH	HG03927.hp1 NA19083.hp1 HG03927.hp1 NA19083.hp1	a0000 a0000	a0000c0013 a0000c0018 a0000c0013 a0000c0018	a0000c0013t0041 a0000c0018t0013 a0000c0013t0041 a0000c0018t0013	a0000c0013t0041g0041 a0000c0018t0013g0090 a0000c0013t0041g0041 a0000c0018t0013g0090	2	267	0.0075	1	c.352 others(5): Show c.3524dupC	p.Pro others(6): Show p.Pro1176fs	ATP2B3	ENSG00000067842.19	transcript	ENST00000263519.5	protein_coding	22/22	4005/6774	3525/3663	1175/1220	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP4A_chr19_35545031_35568658	35562515	G G	GGCACTGC others(13): Show GGCACTGCAGGCCCCCGGCCA	frameshift_variant frameshift_variant	HIGH	HG02135.hp1 HG02135.hp1	a0010 a0010	a0010c0031 a0010c0031	a0010c0031t0001 a0010c0031t0001	a0010c0031t0001g0183 a0010c0031t0001g0183	1	426	0.0024	20	c.320 others(27): Show c.320_339dupTGGCCGGGGGCCTGCAGTGC	p.Leu others(5): Show p.Leu114fs	ATP4A	ENSG00000105675.9	transcript	ENST00000262623.4	protein_coding	4/22	368/3721	339/3108	113/1035		chr19	TogoVar
ATP4A_chr19_35545031_35568658	35563432	A A	AC AC	frameshift_variant frameshift_variant	HIGH	HG01175.hp2 HG01346.hp2 HG01952.hp1 others(8): Show HG01175.hp2 HG01346.hp2 HG01952.hp1 HG02055.hp2 NA18978.hp1 NA18979.hp2 NA18984.hp2 NA19067.hp1 NA19067.hp2 NA19075.hp2 NA19078.hp2	a0003 a0003	a0003c0006 a0003c0011 a0003c0016 others(3): Show a0003c0006 a0003c0011 a0003c0016 a0003c0017 a0003c0018 a0003c0019	a0003c0006t0001 a0003c0011t0002 a0003c0016t0001 others(3): Show a0003c0006t0001 a0003c0011t0002 a0003c0016t0001 a0003c0017t0001 a0003c0018t0001 a0003c0019t0001	a0003c0006t0001g0071 a0003c0006t0001g0073 a0003c0006t0001g0074 others(7): Show a0003c0006t0001g0071 a0003c0006t0001g0073 a0003c0006t0001g0074 a0003c0006t0001g0075 a0003c0006t0001g0077 a0003c0011t0002g0038 a0003c0016t0001g0072 a0003c0017t0001g0069 a0003c0018t0001g0076 a0003c0019t0001g0070	11	426	0.0258	1	c.107 others(4): Show c.107dupG	p.Gly others(4): Show p.Gly37fs	ATP4A	ENSG00000105675.9	transcript	ENST00000262623.4	protein_coding	2/22	136/3721	107/3108	36/1035		chr19	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)