Joint Open Genome and Omics Platform (JoGo)

Search by Variant

Regionname

e.g. ALDH2_chr12_111761933_111822532, HBB_chr11_5220464_5232071.

Chr

Chromosome name (e.g., chr11).

Snpeff genename

Exact SnpEff gene name.

Sampleids

Target sampleid (e.g. HG02615).

Snpeff haplotype class

Haplotype-annotation class (e.g., ahapid, ahapid+chapid).

Snpeff annotation impact

Exact impact level (e.g., HIGH, MODERATE, LOW).

Snpeff annotation impact detail

Keyword match in SnpEff annotation.

Hapid

One or more haplotype IDs (comma-separated; e.g., a0001, a01, a0001c0001, a01c02, a1c2, a0001c0001t0005, a0001c0001t0005g0018).

Samplehapid

Sample haplotype IDs to include (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

No_hapid

Haplotype IDs to exclude (comma-separated; e.g., a0001, a0002, a0001c0001, a0001c0001t0005, a1, a01).

No_samplehapid

Sample haplotype IDs to exclude (comma-separated; e.g., HG02257.hp1, HG02615.hp2, HG00673.hp2).

Start

Start position (GRCh38).

End

End position (GRCh38).

Minac

Minimum alternate allele count (≥).

Maxac

Maximum alternate allele count (≤).

Minlen

Minimum variant length (≥).

Maxlen

Maximum variant length (≤).

Sort By

Select column to sort.

Order by

Ascending or descending.

Show

Results per page.

regionname	pos	ref	alt	annotation	impact	samples	ahapids	achapids	acthapids	actghapids	ac	an	af	len	hgvs_c	hgvs_p	genename	geneid	featuretype	featureid	transcript_biotype	rank	cdna cdna pos length	cds cds pos length	aa aa pos length	status	chr	external
ATP6AP1_chrX_154423677_154441516	154429127	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0008 a0008	a0008c0010 a0008c0010	a0008c0010t0001 a0008c0010t0001	a0008c0010t0001g0023 a0008c0010t0001g0023	1	302	0.0033	-1	c.244 others(4): Show c.244delC	p.Leu others(4): Show p.Leu82fs	ATP6AP1	ENSG00000071553.18	transcript	ENST00000369762.7	protein_coding	2/10	260/2054	244/1413	82/470	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP6AP1_chrX_154423677_154441516	154432445	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19075.hp1 NA19075.hp1	a0008 a0008	a0008c0010 a0008c0010	a0008c0010t0001 a0008c0010t0001	a0008c0010t0001g0023 a0008c0010t0001g0023	1	302	0.0033	-1	c.546 others(4): Show c.546delC	p.Tyr others(5): Show p.Tyr183fs	ATP6AP1	ENSG00000071553.18	transcript	ENST00000369762.7	protein_coding	4/10	562/2054	546/1413	182/470	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP6AP1_chrX_154423677_154441516	154435689	CT CT	C C	frameshift_variant frameshift_variant	HIGH	HG03704.hp2 HG03704.hp2	a0006 a0006	a0006c0006 a0006c0006	a0006c0006t0005 a0006c0006t0005	a0006c0006t0005g0012 a0006c0006t0005g0012	1	302	0.0033	-1	c.121 others(5): Show c.1214delT	p.Phe others(5): Show p.Phe405fs	ATP6AP1	ENSG00000071553.18	transcript	ENST00000369762.7	protein_coding	10/10	1230/2054	1214/1413	405/470	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP6AP1_chrX_154423677_154441516	154435877	AC AC	A A	frameshift_variant frameshift_variant	HIGH	NA18948.hp1 NA18948.hp1	a0000 a0000	a0000c0007 a0000c0007	a0000c0007t0003 a0000c0007t0003	a0000c0007t0003g0006 a0000c0007t0003g0006	1	302	0.0033	-1	c.140 others(5): Show c.1402delC	p.Gln others(5): Show p.Gln468fs	ATP6AP1	ENSG00000071553.18	transcript	ENST00000369762.7	protein_coding	10/10	1418/2054	1402/1413	468/470	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP6AP2_chrX_40575970_40611848	40597277	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA18941.hp2 NA18941.hp2	a0005 a0005	a0005c0008 a0005c0008	a0005c0008t0002 a0005c0008t0002	a0005c0008t0002g0099 a0005c0008t0002g0099	1	299	0.0033	-1	c.332 others(4): Show c.332delA	p.Asn others(5): Show p.Asn111fs	ATP6AP2	ENSG00000182220.15	transcript	ENST00000636580.2	protein_coding	4/9	428/2242	332/1053	111/350	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP7A_chrX_77905693_78055395	78015816	G G	GA GA	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0009 a0009	a0009c0010 a0009c0010	a0009c0010t0026 a0009c0010t0026	a0009c0010t0026g0104 a0009c0010t0026g0104	1	233	0.0043	1	c.256 others(10): Show c.2561_2562insA	p.Lys others(5): Show p.Lys855fs	ATP7A	ENSG00000165240.22	transcript	ENST00000341514.11	protein_coding	12/23	2726/8492	2562/4503	854/1500		chrX	TogoVar
ATP7A_chrX_77905693_78055395	78015869	T T	TC TC	frameshift_variant frameshift_variant	HIGH	NA18974.hp1 NA18974.hp1	a0009 a0009	a0009c0010 a0009c0010	a0009c0010t0026 a0009c0010t0026	a0009c0010t0026g0104 a0009c0010t0026g0104	1	233	0.0043	1	c.261 others(5): Show c.2617dupC	p.Leu others(5): Show p.Leu873fs	ATP7A	ENSG00000165240.22	transcript	ENST00000341514.11	protein_coding	12/23	2782/8492	2618/4503	873/1500	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP7A_chrX_77905693_78055395	78020308	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG02897.hp1 HG02897.hp1	a0013 a0013	a0013c0011 a0013c0011	a0013c0011t0007 a0013c0011t0007	a0013c0011t0007g0175 a0013c0011t0007g0175	1	233	0.0043	1	c.269 others(5): Show c.2694dupG	p.Ser others(5): Show p.Ser899fs	ATP7A	ENSG00000165240.22	transcript	ENST00000341514.11	protein_coding	13/23	2859/8492	2695/4503	899/1500	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATP7A_chrX_77905693_78055395	78038877	CG CG	C C	frameshift_variant frameshift_variant	HIGH	NA18985.hp1 NA18985.hp1	a0012 a0012	a0012c0013 a0012c0013	a0012c0013t0017 a0012c0013t0017	a0012c0013t0017g0102 a0012c0013t0017g0102	1	233	0.0043	-1	c.355 others(5): Show c.3556delG	p.Glu others(6): Show p.Glu1186fs	ATP7A	ENSG00000165240.22	transcript	ENST00000341514.11	protein_coding	18/23	3720/8492	3556/4503	1186/1500	INFO_REALIGN_3_PRIME	chrX	TogoVar
ATXN2L_chr16_28817999_28842232	28835078	T T	TCAGAGCA others(42): Show TCAGAGCAACCCACGCATGCTGACGTCGGGCAGCCATCCCCAGGCCATCG	frameshift_variant frameshift_variant	HIGH	HG03579.hp1 HG03579.hp1	a0006 a0006	a0006c0017 a0006c0017	a0006c0017t0007 a0006c0017t0007	a0006c0017t0007g0091 a0006c0017t0007g0091	1	382	0.0026	49	c.245 others(58): Show c.2455_2503dupCAGAGCAACCCACGCATGCTGACGTCGGGCAGCCAT CCCCAGGCCATCG	p.Val others(5): Show p.Val835fs	ATXN2L	ENSG00000168488.19	transcript	ENST00000336783.9	protein_coding	19/22	2765/4456	2504/3228	835/1075	INFO_REALIGN_3_PRIME	chr16	TogoVar
ATXN3_chr14_92053552_92111582	92071009	C C	CGCGCTGC others(34): Show CGCGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT	frameshift_variant frameshift_variant	HIGH	HG02738.hp2 HG02738.hp2	a0049 a0049	a0049c0053 a0049c0053	a0049c0053t0068 a0049c0053t0068	a0049c0053t0068g0104 a0049c0053t0068g0104	1	402	0.0025	41	c.916 others(48): Show c.916_917insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG CGC	p.Gly others(5): Show p.Gly306fs	ATXN3	ENSG00000066427.25	transcript	ENST00000644486.2	protein_coding	10/11	946/6884	916/1086	306/361		chr14	TogoVar
ATXN3_chr14_92053552_92111582	92071010	C C	CTGCTGCT others(13): Show CTGCTGCTGCTGCTGCTGCTG	frameshift_variant frameshift_variant	HIGH	NA20905.hp1 NA20905.hp1	a0050 a0050	a0050c0056 a0050c0056	a0050c0056t0011 a0050c0056t0011	a0050c0056t0011g0317 a0050c0056t0011g0317	1	402	0.0025	20	c.915 others(27): Show c.915_916insCAGCAGCAGCAGCAGCAGCA	p.Gly others(5): Show p.Gly306fs	ATXN3	ENSG00000066427.25	transcript	ENST00000644486.2	protein_coding	10/11	945/6884	915/1086	305/361		chr14	TogoVar
ATXN3_chr14_92053552_92111582	92071034	G G	GCTGCTGC others(36): Show GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGT	frameshift_variant frameshift_variant	HIGH	NA18956.hp2 NA18956.hp2	a0037 a0037	a0037c0059 a0037c0059	a0037c0059t0002 a0037c0059t0002	a0037c0059t0002g0280 a0037c0059t0002g0280	1	402	0.0025	43	c.891 others(50): Show c.891_892insACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC AGCAG	p.Gln others(5): Show p.Gln298fs	ATXN3	ENSG00000066427.25	transcript	ENST00000644486.2	protein_coding	10/11	921/6884	891/1086	297/361		chr14	TogoVar
ATXN7L2_chr1_109478905_109497734	109487068	TGCCAGCT others(4): Show TGCCAGCTCTCA	T T	frameshift_variant frameshift_variant	HIGH	NA19062.hp2 NA19062.hp2	a0008 a0008	a0008c0003 a0008c0003	a0008c0003t0001 a0008c0003t0001	a0008c0003t0001g0002 a0008c0003t0001g0002	1	332	0.0030	-11	c.362 others(18): Show c.362_372delCCAGCTCTCAG	p.Ala others(5): Show p.Ala121fs	ATXN7L2	ENSG00000162650.17	transcript	ENST00000683729.1	protein_coding	4/11	411/2448	362/2265	121/754	INFO_REALIGN_3_PRIME	chr1	TogoVar
AUNIP_chr1_25829006_25864457	25835277	GTTTCACT others(3): Show GTTTCACTGAT	G G	frameshift_variant frameshift_variant	HIGH	HG01175.hp2 HG01175.hp2	a0006 a0006	a0006c0008 a0006c0008	a0006c0008t0001 a0006c0008t0001	a0006c0008t0001g0145 a0006c0008t0001g0145	1	352	0.0028	-10	c.780 others(17): Show c.780_789delATCAGTGAAA	p.Glu others(5): Show p.Glu260fs	AUNIP	ENSG00000127423.11	transcript	ENST00000374298.4	protein_coding	3/3	889/2161	780/1074	260/357		chr1	TogoVar
AVIL_chr12_57792380_57823734	57811062	CGCTTCAC others(4): Show CGCTTCACGTCG	C C	frameshift_variant frameshift_variant	HIGH	NA19079.hp2 NA19079.hp2	a0005 a0005	a0005c0015 a0005c0015	a0005c0015t0001 a0005c0015t0001	a0005c0015t0001g0104 a0005c0015t0001g0104	1	372	0.0027	-11	c.393 others(18): Show c.393_403delCGACGTGAAGC	p.Tyr others(5): Show p.Tyr131fs	AVIL	ENSG00000135407.11	transcript	ENST00000549994.2	protein_coding	5/20	528/3087	393/2460	131/819		chr12	TogoVar
AVPR2_chrX_153899673_153912166	153905563	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19062.hp1 NA19062.hp1	a0007 a0007	a0007c0011 a0007c0011	a0007c0011t0010 a0007c0011t0010	a0007c0011t0010g0005 a0007c0011t0010g0005	1	322	0.0031	-1	c.60d others(3): Show c.60delC	p.Ser others(4): Show p.Ser21fs	AVPR2	ENSG00000126895.16	transcript	ENST00000646375.2	protein_coding	3/4	331/1825	60/1116	20/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
AVPR2_chrX_153899673_153912166	153905604	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0009 a0009	a0009c0012 a0009c0012	a0009c0012t0005 a0009c0012t0005	a0009c0012t0005g0008 a0009c0012t0005g0008	1	322	0.0031	1	c.101 others(4): Show c.101dupC	p.Leu others(4): Show p.Leu35fs	AVPR2	ENSG00000126895.16	transcript	ENST00000646375.2	protein_coding	3/4	373/1825	102/1116	34/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
AVPR2_chrX_153899673_153912166	153905882	TC TC	T T	frameshift_variant frameshift_variant	HIGH	NA18968.hp1 NA18968.hp1	a0012 a0012	a0012c0018 a0012c0018	a0012c0018t0001 a0012c0018t0001	a0012c0018t0001g0009 a0012c0018t0001g0009	1	322	0.0031	-1	c.378 others(4): Show c.378delC	p.Ser others(5): Show p.Ser127fs	AVPR2	ENSG00000126895.16	transcript	ENST00000646375.2	protein_coding	3/4	649/1825	378/1116	126/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
AVPR2_chrX_153899673_153912166	153905974	G G	GAACCGGC others(6): Show GAACCGGCCGGTGC	frameshift_variant frameshift_variant	HIGH	NA18968.hp1 NA18968.hp1	a0012 a0012	a0012c0018 a0012c0018	a0012c0018t0001 a0012c0018t0001	a0012c0018t0001g0009 a0012c0018t0001g0009	1	322	0.0031	13	c.469 others(20): Show c.469_481dupAACCGGCCGGTGC	p.Leu others(5): Show p.Leu161fs	AVPR2	ENSG00000126895.16	transcript	ENST00000646375.2	protein_coding	3/4	753/1825	482/1116	161/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
AVPR2_chrX_153899673_153912166	153905980	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0009 a0009	a0009c0012 a0009c0012	a0009c0012t0005 a0009c0012t0005	a0009c0012t0005g0008 a0009c0012t0005g0008	1	322	0.0031	1	c.476 others(4): Show c.476dupC	p.Val others(5): Show p.Val160fs	AVPR2	ENSG00000126895.16	transcript	ENST00000646375.2	protein_coding	3/4	748/1825	477/1116	159/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
AVPR2_chrX_153899673_153912166	153906104	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19076.hp1 NA19076.hp1	a0009 a0009	a0009c0012 a0009c0012	a0009c0012t0005 a0009c0012t0005	a0009c0012t0005g0008 a0009c0012t0005g0008	1	322	0.0031	1	c.602 others(4): Show c.602dupG	p.Arg others(5): Show p.Arg202fs	AVPR2	ENSG00000126895.16	transcript	ENST00000646375.2	protein_coding	3/4	874/1825	603/1116	201/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
AVPR2_chrX_153899673_153912166	153906238	T T	TG TG	frameshift_variant frameshift_variant	HIGH	NA19062.hp1 NA19062.hp1	a0007 a0007	a0007c0011 a0007c0011	a0007c0011t0010 a0007c0011t0010	a0007c0011t0010g0005 a0007c0011t0010g0005	1	322	0.0031	1	c.738 others(4): Show c.738dupG	p.Arg others(5): Show p.Arg247fs	AVPR2	ENSG00000126895.16	transcript	ENST00000646375.2	protein_coding	3/4	1010/1825	739/1116	247/371	INFO_REALIGN_3_PRIME	chrX	TogoVar
AWAT1_chrX_70229655_70245659	70240155	G G	GC GC	frameshift_variant frameshift_variant	HIGH	NA19067.hp1 NA19067.hp1	a0003 a0003	a0003c0004 a0003c0004	a0003c0004t0001 a0003c0004t0001	a0003c0004t0001g0001 a0003c0004t0001g0001	1	315	0.0032	1	c.856 others(4): Show c.856dupC	p.Gln others(5): Show p.Gln286fs	AWAT1	ENSG00000204195.4	transcript	ENST00000374521.4	protein_coding	7/7	898/1397	857/987	286/328	INFO_REALIGN_3_PRIME	chrX	TogoVar
AWAT2_chrX_70035542_70054938	70041920	TG TG	T T	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0006 a0003c0003t0006	a0003c0003t0006g0024 a0003c0003t0006g0024	1	338	0.0030	-1	c.889 others(4): Show c.889delC	p.Gln others(5): Show p.Gln297fs	AWAT2	ENSG00000147160.9	transcript	ENST00000276101.7	protein_coding	7/8	895/2124	889/1002	297/333		chrX	TogoVar
AWAT2_chrX_70035542_70054938	70041933	CA CA	C C	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0006 a0003c0003t0006	a0003c0003t0006g0024 a0003c0003t0006g0024	1	338	0.0030	-1	c.876 others(4): Show c.876delT	p.Ile others(5): Show p.Ile292fs	AWAT2	ENSG00000147160.9	transcript	ENST00000276101.7	protein_coding	7/8	882/2124	876/1002	292/333		chrX	TogoVar
AWAT2_chrX_70035542_70054938	70042219	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19072.hp1 NA19072.hp1	a0002 a0002	a0002c0005 a0002c0005	a0002c0005t0008 a0002c0005t0008	a0002c0005t0008g0036 a0002c0005t0008g0036	1	338	0.0030	1	c.814 others(4): Show c.814dupC	p.Leu others(5): Show p.Leu272fs	AWAT2	ENSG00000147160.9	transcript	ENST00000276101.7	protein_coding	6/8	820/2124	814/1002	272/333		chrX	TogoVar
AWAT2_chrX_70035542_70054938	70042320	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0006 a0003c0003t0006	a0003c0003t0006g0024 a0003c0003t0006g0024	1	338	0.0030	1	c.713 others(4): Show c.713dupC	p.Gly others(5): Show p.Gly239fs	AWAT2	ENSG00000147160.9	transcript	ENST00000276101.7	protein_coding	6/8	719/2124	713/1002	238/333		chrX	TogoVar
AWAT2_chrX_70035542_70054938	70043153	GC GC	G G	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0006 a0003c0003t0006	a0003c0003t0006g0024 a0003c0003t0006g0024	1	338	0.0030	-1	c.562 others(4): Show c.562delG	p.Ala others(5): Show p.Ala188fs	AWAT2	ENSG00000147160.9	transcript	ENST00000276101.7	protein_coding	5/8	568/2124	562/1002	188/333		chrX	TogoVar
AWAT2_chrX_70035542_70054938	70043177	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0006 a0003c0003t0006	a0003c0003t0006g0024 a0003c0003t0006g0024	1	338	0.0030	1	c.538 others(4): Show c.538dupG	p.Val others(5): Show p.Val180fs	AWAT2	ENSG00000147160.9	transcript	ENST00000276101.7	protein_coding	5/8	544/2124	538/1002	180/333		chrX	TogoVar
AWAT2_chrX_70035542_70054938	70043208	GA GA	G G	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0006 a0003c0003t0006	a0003c0003t0006g0024 a0003c0003t0006g0024	1	338	0.0030	-1	c.507 others(4): Show c.507delT	p.Leu others(5): Show p.Leu170fs	AWAT2	ENSG00000147160.9	transcript	ENST00000276101.7	protein_coding	5/8	513/2124	507/1002	169/333		chrX	TogoVar
AWAT2_chrX_70035542_70054938	70043639	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19059.hp2 NA19059.hp2	a0003 a0003	a0003c0003 a0003c0003	a0003c0003t0006 a0003c0003t0006	a0003c0003t0006g0024 a0003c0003t0006g0024	1	338	0.0030	1	c.310 others(4): Show c.310dupC	p.Leu others(5): Show p.Leu104fs	AWAT2	ENSG00000147160.9	transcript	ENST00000276101.7	protein_coding	4/8	316/2124	310/1002	104/333		chrX	TogoVar
AZGP1_chr7_99961730_99981031	99971947	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG00673.hp1 HG01261.hp2 NA18972.hp2 others(4): Show HG00673.hp1 HG01261.hp2 NA18972.hp2 NA18981.hp1 NA18991.hp2 NA18998.hp2 NA19083.hp1	a0002 a0002	a0002c0004 a0002c0006 a0002c0004 a0002c0006	a0002c0004t0001 a0002c0006t0001 a0002c0004t0001 a0002c0006t0001	a0002c0004t0001g0048 a0002c0004t0001g0079 a0002c0004t0001g0090 others(3): Show a0002c0004t0001g0048 a0002c0004t0001g0079 a0002c0004t0001g0090 a0002c0004t0001g0111 a0002c0006t0001g0121 a0002c0006t0001g0122	7	432	0.0162	1	c.135 others(4): Show c.135dupC	p.Ala others(4): Show p.Ala46fs	AZGP1	ENSG00000160862.13	transcript	ENST00000292401.9	protein_coding	2/4	146/1181	135/897	45/298		chr7	TogoVar
AZU1_chr19_822837_837018	830862	TGACTGTG others(43): Show TGACTGTGACCCCCGAGGACCAGTGTCGCCCCAACAACGTGTGCACCGGT G	T T	frameshift_variant frameshift_variant	HIGH	HG02027.hp1 HG02027.hp1	a0006 a0006	a0006c0017 a0006c0017	a0006c0017t0001 a0006c0017t0001	a0006c0017t0001g0002 a0006c0017t0001g0002	1	391	0.0026	-50	c.516 others(57): Show c.516_565delGACTGTGACCCCCGAGGACCAGTGTCGCCCCAACAACG TGTGCACCGGTG	p.Thr others(5): Show p.Thr173fs	AZU1	ENSG00000172232.10	transcript	ENST00000233997.4	protein_coding	4/5	526/907	516/756	172/251		chr19	TogoVar
B3GNT3_chr19_17790138_17818576	17811688	C C	CTGGCACC others(4): Show CTGGCACCTCTG	frameshift_variant frameshift_variant	HIGH	NA18955.hp2 NA18955.hp2	a0006 a0006	a0006c0010 a0006c0010	a0006c0010t0006 a0006c0010t0006	a0006c0010t0006g0161 a0006c0010t0006g0161	1	406	0.0025	11	c.685 others(18): Show c.685_686insTGGCACCTCTG	p.Pro others(5): Show p.Pro229fs	B3GNT3	ENSG00000179913.11	transcript	ENST00000318683.7	protein_coding	3/3	805/2692	686/1119	229/372		chr19	TogoVar
B4GALNT3_chr12_454939_568509	546693	CCAAATTT others(4): Show CCAAATTTCCAA	C C	frameshift_variant frameshift_variant	HIGH	NA18988.hp2 NA18988.hp2	a0025 a0025	a0025c0029 a0025c0029	a0025c0029t0003 a0025c0029t0003	a0025c0029t0003g0370 a0025c0029t0003g0370	1	394	0.0025	-11	c.688 others(18): Show c.688_698delCAAATTTCCAA	p.Gln others(5): Show p.Gln230fs	B4GALNT3	ENSG00000139044.12	transcript	ENST00000266383.10	protein_coding	7/20	1126/5493	688/2997	230/998		chr12	TogoVar
B4GALNT4_chr11_364499_387117	372179	GGACTCCA others(4): Show GGACTCCAGTGA	G G	frameshift_variant frameshift_variant	HIGH	HG01975.hp2 HG01975.hp2	a0023 a0023	a0023c0035 a0023c0035	a0023c0035t0001 a0023c0035t0001	a0023c0035t0001g0005 a0023c0035t0001g0005	1	184	0.0054	-11	c.225 others(18): Show c.225_235delCTCCAGTGAGA	p.Asp others(4): Show p.Asp75fs	B4GALNT4	ENSG00000182272.12	transcript	ENST00000329962.11	protein_coding	2/20	530/3750	225/3120	75/1039	INFO_REALIGN_3_PRIME	chr11	TogoVar
B4GALNT4_chr11_364499_387117	379511	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG00544.hp1 HG01255.hp1 HG01952.hp2 others(7): Show HG00544.hp1 HG01255.hp1 HG01952.hp2 HG03098.hp1 HG03486.hp2 HG03490.hp2 HG03516.hp2 HG03669.hp2 HG03927.hp2 HG06807.hp2	a0003 a0005 a0018 others(1): Show a0003 a0005 a0018 a0022	a0003c0006 a0005c0009 a0018c0026 others(1): Show a0003c0006 a0005c0009 a0018c0026 a0022c0029	a0003c0006t0001 a0005c0009t0001 a0018c0026t0004 others(1): Show a0003c0006t0001 a0005c0009t0001 a0018c0026t0004 a0022c0029t0001	a0003c0006t0001g0026 a0003c0006t0001g0088 a0003c0006t0001g0102 others(7): Show a0003c0006t0001g0026 a0003c0006t0001g0088 a0003c0006t0001g0102 a0003c0006t0001g0157 a0003c0006t0001g0178 a0005c0009t0001g0118 a0005c0009t0001g0131 a0005c0009t0001g0138 a0018c0026t0004g0042 a0022c0029t0001g0135	10	184	0.0544	1	c.230 others(5): Show c.2303dupG	p.Gly others(5): Show p.Gly769fs	B4GALNT4	ENSG00000182272.12	transcript	ENST00000329962.11	protein_coding	15/20	2609/3750	2304/3120	768/1039	INFO_REALIGN_3_PRIME	chr11	TogoVar
B4GALT2_chr1_43974210_43996168	43990356	C C	CG CG	frameshift_variant frameshift_variant	HIGH	HG00741.hp1 HG01928.hp1 HG01978.hp2 others(4): Show HG00741.hp1 HG01928.hp1 HG01978.hp2 HG03710.hp2 NA18940.hp2 NA18959.hp1 NA18993.hp2	a0000 a0000	a0000c0004 a0000c0007 a0000c0004 a0000c0007	a0000c0004t0001 a0000c0007t0003 a0000c0004t0001 a0000c0007t0003	a0000c0004t0001g0014 a0000c0004t0001g0028 a0000c0004t0001g0145 others(4): Show a0000c0004t0001g0014 a0000c0004t0001g0028 a0000c0004t0001g0145 a0000c0004t0001g0202 a0000c0004t0001g0204 a0000c0004t0001g0208 a0000c0007t0003g0008	7	406	0.0172	1	c.102 others(5): Show c.1029dupG	p.Tyr others(5): Show p.Tyr344fs	B4GALT2	ENSG00000117411.18	transcript	ENST00000372324.6	protein_coding	7/7	1384/2193	1030/1119	344/372	INFO_REALIGN_3_PRIME	chr1	TogoVar
BAIAP3_chr16_1328645_1354439	1346751	C C	CGGAGGCC others(94): Show CGGAGGCCCTGTGGGAGCTACTCCTCCAGGCCATTCTGCAGGTGGGGCCA GCGGGGCAGGTGGGGCTGGCCCGTGGTCACTGATGCTGCCCTGCAGGGTG CT	frameshift_variant others(1): Show frameshift_variant stop_gained	HIGH	HG01069.hp2 HG02970.hp2 HG03486.hp2 HG01069.hp2 HG02970.hp2 HG03486.hp2	a0001 a0001	a0001c0001 a0001c0001	a0001c0001t0001 a0001c0001t0001	a0001c0001t0001g0107 a0001c0001t0001g0141 a0001c0001t0001g0142 a0001c0001t0001g0107 a0001c0001t0001g0141 a0001c0001t0001g0142	3	358	0.0084	101	c.264 others(113): Show c.2643-54_2689dupTGGGGCCAGCGGGGCAGGTGGGGCTGGCCCGTG GTCACTGATGCTGCCCTGCAGGGTGCTGGAGGCCCTGTGGGAGCTACTCC TCCAGGCCATTCTGCAGG	p.Ala others(5): Show p.Ala897fs	BAIAP3	ENSG00000007516.15	transcript	ENST00000426824.8	protein_coding	28/34	2805/4531	2690/3459	897/1152	INFO_REALIGN_3_PRIME	chr16	TogoVar
BAIAP3_chr16_1328645_1354439	1346751	CGGAGGCC others(94): Show CGGAGGCCCTGTGGGAGCTACTCCTCCAGGCCATTCTGCAGGTGGGGCCA GCGGGGCAGGTGGGGCTGGCCCGTGGTCACTGATGCTGCCCTGCAGGGTG CT	C C	frameshift_variant others(3): Show frameshift_variant splice_acceptor_variant splice_region_variant intron_variant	HIGH	HG01123.hp1 HG01123.hp1	a0010 a0010	a0010c0035 a0010c0035	a0010c0035t0008 a0010c0035t0008	a0010c0035t0008g0075 a0010c0035t0008g0075	1	358	0.0028	-101	c.264 others(12): Show c.2643-54_2689del	p.Arg others(5): Show p.Arg881fs	BAIAP3	ENSG00000007516.15	transcript	ENST00000426824.8	protein_coding	28/34		2643/3459	881/1152	INFO_REALIGN_3_PRIME	chr16	TogoVar
BBS12_chr4_122727704_122749939	122742768	G G	GCAATATC others(27): Show GCAATATCAGAATGCTTGTGTGCAACAAGGCAACT	frameshift_variant frameshift_variant	HIGH	HG02922.hp1 HG02922.hp1	a0017 a0017	a0017c0015 a0017c0015	a0017c0015t0001 a0017c0015t0001	a0017c0015t0001g0086 a0017c0015t0001g0086	1	364	0.0028	34	c.877 others(41): Show c.877_910dupCAATATCAGAATGCTTGTGTGCAACAAGGCAACT	p.Cys others(5): Show p.Cys304fs	BBS12	ENSG00000181004.10	transcript	ENST00000314218.8	protein_coding	2/2	1102/3238	911/2133	304/710	INFO_REALIGN_3_PRIME	chr4	TogoVar
BBS4_chr15_72681207_72743473	72735139	GAAAATGC others(133): Show GAAAATGCCAAGAGAGCCTACGCAGAAGCAGTCCACCTGGATAAGTATGC ACTTTGTTGAGAATGGTACTGGCGGGGGTTGGACTCTCCAAAGCCATGAG GTGGTGCCATACATAGCATTGGTGCTGCCTGTGTCAGCCCA	G G	frameshift_variant others(3): Show frameshift_variant splice_donor_variant splice_region_variant intron_variant	HIGH	HG00558.hp2 HG00558.hp2	a0008 a0008	a0008c0012 a0008c0012	a0008c0012t0001 a0008c0012t0001	a0008c0012t0001g0032 a0008c0012t0001g0032	1	398	0.0025	-140	c.106 others(12): Show c.1064_1106+97del	p.Glu others(5): Show p.Glu355fs	BBS4	ENSG00000140463.14	transcript	ENST00000268057.9	protein_coding	13/16	1085/2467	1064/1560	355/519		chr15	TogoVar
BCAP31_chrX_153695492_153729387	153720868	TCACCGAT others(1): Show TCACCGATG	T T	frameshift_variant others(3): Show frameshift_variant splice_donor_variant splice_region_variant intron_variant	HIGH	NA19068.hp1 NA19068.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0135 a0002c0002t0001g0135	1	267	0.0038	-8	c.189 others(17): Show c.189_193+3delCATCGGTG	p.Ile others(4): Show p.Ile64fs	BCAP31	ENSG00000185825.17	transcript	ENST00000345046.12	protein_coding	3/8		189/741	63/246		chrX	TogoVar
BCAP31_chrX_153695492_153729387	153720880	A A	AC AC	frameshift_variant frameshift_variant	HIGH	NA19068.hp1 NA19068.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0135 a0002c0002t0001g0135	1	267	0.0038	1	c.184 others(8): Show c.184_185insG	p.Leu others(4): Show p.Leu62fs	BCAP31	ENSG00000185825.17	transcript	ENST00000345046.12	protein_coding	3/8	282/1284	184/741	62/246		chrX	TogoVar
BCAP31_chrX_153695492_153729387	153720886	A A	AG AG	frameshift_variant frameshift_variant	HIGH	NA19068.hp1 NA19068.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0135 a0002c0002t0001g0135	1	267	0.0038	1	c.178 others(8): Show c.178_179insC	p.Val others(4): Show p.Val60fs	BCAP31	ENSG00000185825.17	transcript	ENST00000345046.12	protein_coding	3/8	276/1284	178/741	60/246		chrX	TogoVar
BCAP31_chrX_153695492_153729387	153720894	GAC GAC	G G	frameshift_variant frameshift_variant	HIGH	NA19068.hp1 NA19068.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0135 a0002c0002t0001g0135	1	267	0.0038	-2	c.169 others(9): Show c.169_170delGT	p.Val others(4): Show p.Val57fs	BCAP31	ENSG00000185825.17	transcript	ENST00000345046.12	protein_coding	3/8	268/1284	169/741	57/246		chrX	TogoVar
BCAP31_chrX_153695492_153729387	153720902	GAACC GAACC	G G	frameshift_variant frameshift_variant	HIGH	NA19068.hp1 NA19068.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0135 a0002c0002t0001g0135	1	267	0.0038	-4	c.159 others(11): Show c.159_162delGGTT	p.Val others(4): Show p.Val54fs	BCAP31	ENSG00000185825.17	transcript	ENST00000345046.12	protein_coding	3/8	260/1284	159/741	53/246		chrX	TogoVar
BCAP31_chrX_153695492_153729387	153720910	AAGAAG AAGAAG	A A	frameshift_variant frameshift_variant	HIGH	NA19068.hp1 NA19068.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0135 a0002c0002t0001g0135	1	267	0.0038	-5	c.150 others(12): Show c.150_154delCTTCT	p.Phe others(4): Show p.Phe51fs	BCAP31	ENSG00000185825.17	transcript	ENST00000345046.12	protein_coding	3/8	252/1284	150/741	50/246		chrX	TogoVar
BCAP31_chrX_153695492_153729387	153720922	CCA CCA	C C	frameshift_variant frameshift_variant	HIGH	NA19068.hp1 NA19068.hp1	a0002 a0002	a0002c0002 a0002c0002	a0002c0002t0001 a0002c0002t0001	a0002c0002t0001g0135 a0002c0002t0001g0135	1	267	0.0038	-2	c.141 others(9): Show c.141_142delTG	p.Tyr others(4): Show p.Tyr47fs	BCAP31	ENSG00000185825.17	transcript	ENST00000345046.12	protein_coding	3/8	240/1284	141/741	47/246		chrX	TogoVar

Search by Variant

Search

Search Results (Total: 5828 hits)